Transcript: Human NM_004227.4

Homo sapiens cytohesin 3 (CYTH3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CYTH3 (9265)
Length:
4482
CDS:
118..1317

Additional Resources:

NCBI RefSeq record:
NM_004227.4
NBCI Gene record:
CYTH3 (9265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428634 TGGGTGAAAGGGATGAATTTA pLKO_005 476 CDS 100% 15.000 10.500 N CYTH3 n/a
2 TRCN0000183827 CCTGGTTCATATTTGAGTTTA pLKO.1 3990 3UTR 100% 13.200 9.240 N CYTH3 n/a
3 TRCN0000414135 GCCTAAATAAGACCGTCATTG pLKO_005 446 CDS 100% 10.800 7.560 N CYTH3 n/a
4 TRCN0000421473 TGATGACAGAGATCGACAATC pLKO_005 260 CDS 100% 10.800 7.560 N CYTH3 n/a
5 TRCN0000179924 CCTGAAGACCTCTCATTAGAA pLKO.1 154 CDS 100% 5.625 3.938 N CYTH3 n/a
6 TRCN0000146607 CCCTGGTTCATATTTGAGTTT pLKO.1 3989 3UTR 100% 4.950 3.465 N CYTH3 n/a
7 TRCN0000179183 GATGACATTGAGAGGCTGAAA pLKO.1 223 CDS 100% 4.950 3.465 N CYTH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004227.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15663 pDONR223 0% 44.7% 44.8% None 1_660del;1032T>G n/a
2 ccsbBroad304_15663 pLX_304 0% 44.7% 44.8% V5 1_660del;1032T>G n/a
3 TRCN0000467209 ATCGCCCAGGGTACGTTCCTAGCC pLX_317 8% 44.7% 44.8% V5 1_660del;1032T>G n/a
Download CSV