Transcript: Human NM_004276.5

Homo sapiens calcium binding protein 1 (CABP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CABP1 (9478)
Length:
1289
CDS:
362..865

Additional Resources:

NCBI RefSeq record:
NM_004276.5
NBCI Gene record:
CABP1 (9478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004276.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029359 CGAGATGCTTTCCGAGAGTTT pLKO.1 674 CDS 100% 4.950 6.930 N CABP1 n/a
2 TRCN0000420059 TCCGCACTGTGAAAGACTAAC pLKO_005 1024 3UTR 100% 10.800 8.640 N CABP1 n/a
3 TRCN0000029362 GTCCCAGCAGATCAACATGAA pLKO.1 559 CDS 100% 4.950 3.960 N CABP1 n/a
4 TRCN0000029360 CCGAGACATAGAGGAAATTAT pLKO.1 775 CDS 100% 15.000 10.500 N CABP1 n/a
5 TRCN0000414193 ACAGCAGATATGATTGGTGTA pLKO_005 644 CDS 100% 4.050 2.835 N CABP1 n/a
6 TRCN0000029361 CTGCGACCAGAGGAAATTGAA pLKO.1 416 CDS 100% 5.625 3.375 N CABP1 n/a
7 TRCN0000029363 GAGAAATCTCTCAAGGAAGAT pLKO.1 388 CDS 100% 4.950 3.465 N CABP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004276.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11372 pDONR223 100% 53.9% 50.9% None (many diffs) n/a
2 ccsbBroad304_11372 pLX_304 0% 53.9% 50.9% V5 (many diffs) n/a
3 TRCN0000467078 GTACCATCTACACTATCAATTAAC pLX_317 44.3% 53.9% 50.9% V5 (many diffs) n/a
Download CSV