Transcript: Human NM_004284.6

Homo sapiens chromodomain helicase DNA binding protein 1 like (CHD1L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CHD1L (9557)
Length:
2967
CDS:
21..2714

Additional Resources:

NCBI RefSeq record:
NM_004284.6
NBCI Gene record:
CHD1L (9557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004284.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013469 GCAGGAAGATTAAATGATGAA pLKO.1 285 CDS 100% 4.950 6.930 N CHD1L n/a
2 TRCN0000297836 GCAGGAAGATTAAATGATGAA pLKO_005 285 CDS 100% 4.950 6.930 N CHD1L n/a
3 TRCN0000013472 CGTATTGGACATGCCACGAAA pLKO.1 2544 CDS 100% 4.950 3.465 N CHD1L n/a
4 TRCN0000280395 CGTATTGGACATGCCACGAAA pLKO_005 2544 CDS 100% 4.950 3.465 N CHD1L n/a
5 TRCN0000013471 GCCAAGAGAAGGAGACTCATA pLKO.1 1974 CDS 100% 4.950 3.465 N CHD1L n/a
6 TRCN0000280441 GCCAAGAGAAGGAGACTCATA pLKO_005 1974 CDS 100% 4.950 3.465 N CHD1L n/a
7 TRCN0000013468 CCTGTCTTTAGCAACCAGCTA pLKO.1 2735 3UTR 100% 2.640 1.848 N CHD1L n/a
8 TRCN0000297839 CCTGTCTTTAGCAACCAGCTA pLKO_005 2735 3UTR 100% 2.640 1.848 N CHD1L n/a
9 TRCN0000013470 GCACAAACTCTTGCAGCCATT pLKO.1 770 CDS 100% 4.050 2.430 N CHD1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004284.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11389 pDONR223 100% 77.2% 77.2% None 125_736del;1269A>G n/a
2 ccsbBroad304_11389 pLX_304 0% 77.2% 77.2% V5 125_736del;1269A>G n/a
3 TRCN0000479276 GCTGATGTGCAGGCAAGTTCTTGA pLX_317 18% 77.2% 77.2% V5 125_736del;1269A>G n/a
Download CSV