Transcript: Human NM_004331.3

Homo sapiens BCL2 interacting protein 3 like (BNIP3L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
BNIP3L (665)
Length:
3452
CDS:
78..737

Additional Resources:

NCBI RefSeq record:
NM_004331.3
NBCI Gene record:
BNIP3L (665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007846 GCTAGGCATCTATATTGGAAA pLKO.1 683 CDS 100% 4.950 6.930 N BNIP3L n/a
2 TRCN0000293448 GCTAGGCATCTATATTGGAAA pLKO_005 683 CDS 100% 4.950 6.930 N BNIP3L n/a
3 TRCN0000298517 TATTGTCACAGTAGCTTATTT pLKO_005 784 3UTR 100% 15.000 10.500 N BNIP3L n/a
4 TRCN0000293449 ATCATGTTTGATGTGGAAATG pLKO_005 387 CDS 100% 10.800 7.560 N BNIP3L n/a
5 TRCN0000293521 CCTCATCCTCCATCCACAATG pLKO_005 262 CDS 100% 10.800 7.560 N BNIP3L n/a
6 TRCN0000009733 GATGGGCAGATCATGTTTGAT pLKO.1 378 CDS 100% 5.625 3.938 N Bnip3l n/a
7 TRCN0000007845 CCCTAAACGTTCTGTGTCTTT pLKO.1 557 CDS 100% 4.950 3.465 N BNIP3L n/a
8 TRCN0000007848 CAATGATAATGGCAATGGGAA pLKO.1 215 CDS 100% 2.640 1.848 N BNIP3L n/a
9 TRCN0000007847 CAGTCAGAAGAAGAAGTTGTA pLKO.1 432 CDS 100% 4.950 2.970 N BNIP3L n/a
10 TRCN0000293518 CAGTCAGAAGAAGAAGTTGTA pLKO_005 432 CDS 100% 4.950 2.970 N BNIP3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00171 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00171 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467222 AGAGGCTATGTACACTGCCGAGAG pLX_317 56.2% 100% 100% V5 n/a
Download CSV