Transcript: Human NM_004361.5

Homo sapiens cadherin 7 (CDH7), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CDH7 (1005)
Length:
12136
CDS:
336..2693

Additional Resources:

NCBI RefSeq record:
NM_004361.5
NBCI Gene record:
CDH7 (1005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004361.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054162 GTCCAGATCAAAGCCCTATTT pLKO.1 428 CDS 100% 13.200 10.560 N CDH7 n/a
2 TRCN0000448164 AGAGGCTAAAGACCAGTATTT pLKO_005 995 CDS 100% 13.200 9.240 N CDH7 n/a
3 TRCN0000054161 GCCAGAGTGGTCTACAGTATT pLKO.1 900 CDS 100% 13.200 9.240 N CDH7 n/a
4 TRCN0000054158 CCCTAACTGATGTCAACGATA pLKO.1 1087 CDS 100% 4.950 3.465 N CDH7 n/a
5 TRCN0000094788 GCAAAGGATATGGTTGGTCAA pLKO.1 1029 CDS 100% 4.050 2.835 N Cdh7 n/a
6 TRCN0000054159 GCCAGAATTAAAGCTGCTGAT pLKO.1 1179 CDS 100% 4.050 2.835 N CDH7 n/a
7 TRCN0000054160 CGTCACTATGAGAAGACGGAA pLKO.1 2216 CDS 100% 2.640 1.848 N CDH7 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7422 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 10543 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7422 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004361.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10725 pDONR223 100% 78.8% 78.2% None (many diffs) n/a
2 ccsbBroad304_10725 pLX_304 0% 78.8% 78.2% V5 (many diffs) n/a
3 TRCN0000479284 AATCGACTTTAACAATCCCGACCT pLX_317 22.7% 78.8% 78.2% V5 (many diffs) n/a
Download CSV