Transcript: Human NM_004483.5

Homo sapiens glycine cleavage system protein H (GCSH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
GCSH (2653)
Length:
1560
CDS:
118..639

Additional Resources:

NCBI RefSeq record:
NM_004483.5
NBCI Gene record:
GCSH (2653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004483.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083393 CGTTGGGAGATGTTGTTTATT pLKO.1 350 CDS 100% 15.000 9.000 N GCSH n/a
2 TRCN0000431141 AGGAGAAGTAACTGAAATTAA pLKO_005 468 CDS 100% 15.000 7.500 Y GCSH n/a
3 TRCN0000083395 GTGAACTCTATTCTCCTTTAT pLKO.1 446 CDS 100% 13.200 6.600 Y GCSH n/a
4 TRCN0000414026 GTGGATAGAAGACTTAGAATA pLKO_005 705 3UTR 100% 13.200 6.600 Y GCSH n/a
5 TRCN0000428788 TGAGGAACACCACTATCTTAA pLKO_005 1074 3UTR 100% 13.200 6.600 Y GCSH n/a
6 TRCN0000420734 TTTGGGATGAAATACTTAATG pLKO_005 995 3UTR 100% 13.200 6.600 Y GCSH n/a
7 TRCN0000431977 GAACAGTGGGAATCAGCAATT pLKO_005 317 CDS 100% 10.800 5.400 Y GCSH n/a
8 TRCN0000083397 CAGGACTTGTAAACAAATCTT pLKO.1 509 CDS 100% 5.625 2.813 Y GCSH n/a
9 TRCN0000083396 GATGAACTTATGAGTGAAGAA pLKO.1 583 CDS 100% 4.950 2.475 Y GCSH n/a
10 TRCN0000083394 GTGCGTAAATTCACAGAGAAA pLKO.1 265 CDS 100% 4.950 2.475 Y GCSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004483.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06268 pDONR223 100% 99.8% 99.4% None 62C>T n/a
2 ccsbBroad304_06268 pLX_304 0% 99.8% 99.4% V5 62C>T n/a
3 TRCN0000471706 TCATGCTTAGTCCCCTTTCGGGCA pLX_317 64.1% 99.8% 99.4% V5 62C>T n/a
4 ccsbBroadEn_10843 pDONR223 100% 56.2% 56% None 62C>T;294_519delinsC n/a
5 ccsbBroad304_10843 pLX_304 0% 56.2% 56% V5 62C>T;294_519delinsC n/a
6 TRCN0000466691 TCCAACGCAGCACACTCACTGTGG pLX_317 82.4% 56.2% 56% V5 62C>T;294_519delinsC n/a
Download CSV