Transcript: Human NM_004493.3

Homo sapiens hydroxysteroid 17-beta dehydrogenase 10 (HSD17B10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
HSD17B10 (3028)
Length:
954
CDS:
26..811

Additional Resources:

NCBI RefSeq record:
NM_004493.3
NBCI Gene record:
HSD17B10 (3028)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220831 GCTAGCAAGACGTACAACTTA pLKO.1 314 CDS 100% 5.625 7.875 N HSD17B10 n/a
2 TRCN0000318872 GCTAGCAAGACGTACAACTTA pLKO_005 314 CDS 100% 5.625 7.875 N HSD17B10 n/a
3 TRCN0000220832 AGTTAGGAAACAACTGCGTTT pLKO.1 183 CDS 100% 4.050 5.670 N HSD17B10 n/a
4 TRCN0000318935 AGTTAGGAAACAACTGCGTTT pLKO_005 183 CDS 100% 4.050 5.670 N HSD17B10 n/a
5 TRCN0000220830 CCAGCGAGTTCTTGATGTGAA pLKO.1 367 CDS 100% 4.950 3.960 N HSD17B10 n/a
6 TRCN0000220834 GACCCATACCTTGGAAGACTT pLKO.1 346 CDS 100% 4.950 3.465 N HSD17B10 n/a
7 TRCN0000318937 GACCCATACCTTGGAAGACTT pLKO_005 346 CDS 100% 4.950 3.465 N HSD17B10 n/a
8 TRCN0000220833 CATCGAGAACCCATTCCTCAA pLKO.1 745 CDS 100% 4.050 2.835 N HSD17B10 n/a
9 TRCN0000318938 CATCGAGAACCCATTCCTCAA pLKO_005 745 CDS 100% 4.050 2.835 N HSD17B10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00723 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00723 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474971 GATCACGAATTCTATTATACCTTT pLX_317 66.7% 100% 100% V5 n/a
4 ccsbBroadEn_00722 pDONR223 100% 96.5% 96.5% None 567_593del n/a
5 ccsbBroad304_00722 pLX_304 0% 96.5% 96.5% V5 567_593del n/a
6 TRCN0000467186 GGTCAAGCTTATCGCCCTTGGGAG pLX_317 47.8% 96.5% 96.5% V5 567_593del n/a
Download CSV