Transcript: Human NM_004501.3

Homo sapiens heterogeneous nuclear ribonucleoprotein U (HNRNPU), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HNRNPU (3192)
Length:
6789
CDS:
219..2639

Additional Resources:

NCBI RefSeq record:
NM_004501.3
NBCI Gene record:
HNRNPU (3192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320516 AGATCATGGCCGTGGATATTT pLKO_005 914 CDS 100% 15.000 21.000 N HNRNPU n/a
2 TRCN0000320585 TGCCCGAAAGAAGCGAAATTT pLKO_005 1871 CDS 100% 15.000 21.000 N HNRNPU n/a
3 TRCN0000001297 CGATAAGAGAATGTGTCAGTA pLKO.1 2857 3UTR 100% 4.950 6.930 N HNRNPU n/a
4 TRCN0000320515 GACTCTGTACTGCTCATATTA pLKO_005 3094 3UTR 100% 15.000 10.500 N HNRNPU n/a
5 TRCN0000340591 AGAAGCTTTGTGGGTTGATTT pLKO_005 2763 3UTR 100% 13.200 9.240 N Hnrnpu n/a
6 TRCN0000001298 CAGTGCTTCTTCCCTTACAAT pLKO.1 1079 CDS 100% 5.625 3.938 N HNRNPU n/a
7 TRCN0000350256 CAGTGCTTCTTCCCTTACAAT pLKO_005 1079 CDS 100% 5.625 3.938 N HNRNPU n/a
8 TRCN0000120020 CAGTGGTTTGTCTTGATACTT pLKO.1 1018 CDS 100% 5.625 3.938 N Hnrnpu n/a
9 TRCN0000001299 GCAACTGTGAGACTGAAGATT pLKO.1 1327 CDS 100% 5.625 3.938 N HNRNPU n/a
10 TRCN0000320513 GCAACTGTGAGACTGAAGATT pLKO_005 1327 CDS 100% 5.625 3.938 N HNRNPU n/a
11 TRCN0000001300 AGGGAACTACAACCAGAACTT pLKO.1 2498 CDS 100% 4.950 3.465 N HNRNPU n/a
12 TRCN0000001301 GAACAAGTATAGCAGAGCCAA pLKO.1 950 CDS 100% 2.640 1.848 N HNRNPU n/a
13 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 6000 3UTR 100% 4.950 2.475 Y DENND6A n/a
14 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 6039 3UTR 100% 4.050 2.025 Y ERN2 n/a
15 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 475 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004501.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468483 AAGCTCTTCGCTAGCGTTAGCACT pLX_317 16.3% 85% 84.8% V5 (many diffs) n/a
Download CSV