Transcript: Human NM_004502.4

Homo sapiens homeobox B7 (HOXB7), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HOXB7 (3217)
Length:
1363
CDS:
100..753

Additional Resources:

NCBI RefSeq record:
NM_004502.4
NBCI Gene record:
HOXB7 (3217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004502.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015945 CGAGAGTAACTTCCGGATCTA pLKO.1 459 CDS 100% 4.950 6.930 N HOXB7 n/a
2 TRCN0000015947 CGAGCCGAGTTCCTTCAACAT pLKO.1 339 CDS 100% 4.950 6.930 N HOXB7 n/a
3 TRCN0000414978 AGAGTAACTTCCGGATCTACC pLKO_005 461 CDS 100% 4.050 3.240 N Hoxb7 n/a
4 TRCN0000015946 AGAACAAACTTCTTGTGCGTT pLKO.1 180 CDS 100% 2.640 2.112 N HOXB7 n/a
5 TRCN0000015944 CCTCACGGAAAGACAGATCAA pLKO.1 624 CDS 100% 4.950 3.465 N HOXB7 n/a
6 TRCN0000285117 CCTCACGGAAAGACAGATCAA pLKO_005 624 CDS 100% 4.950 3.465 N HOXB7 n/a
7 TRCN0000273962 GAAGAGTGAGGGATGGAGAAA pLKO_005 745 CDS 100% 4.950 3.465 N HOXB7 n/a
8 TRCN0000274015 ATCCAGCCTCAAGTTCGGTTT pLKO_005 140 CDS 100% 4.050 2.835 N HOXB7 n/a
9 TRCN0000274016 ATGCGAAGCTCAGGAACTGAC pLKO_005 487 CDS 100% 4.050 2.835 N HOXB7 n/a
10 TRCN0000015943 GCCCTCTTTAATGCTGTCTTT pLKO.1 1120 3UTR 100% 4.950 2.970 N HOXB7 n/a
11 TRCN0000273963 GCCCTCTTTAATGCTGTCTTT pLKO_005 1120 3UTR 100% 4.950 2.970 N HOXB7 n/a
12 TRCN0000055172 GCTGGAGAAAGAATTTCACTA pLKO.1 552 CDS 100% 4.950 2.970 N Hoxb7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004502.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06392 pDONR223 100% 99.8% 99.5% None 25A>G n/a
2 ccsbBroad304_06392 pLX_304 0% 99.8% 99.5% V5 25A>G n/a
3 TRCN0000475437 AGGGAGCTTCATAGAACTAACTCT pLX_317 64.9% 99.8% 99.5% V5 25A>G n/a
Download CSV