Transcript: Human NM_004615.3

Homo sapiens tetraspanin 7 (TSPAN7), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TSPAN7 (7102)
Length:
1816
CDS:
70..819

Additional Resources:

NCBI RefSeq record:
NM_004615.3
NBCI Gene record:
TSPAN7 (7102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004615.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379786 GTTAACCAGAAGGGTTGTTAT pLKO_005 655 CDS 100% 13.200 18.480 N TSPAN7 n/a
2 TRCN0000382099 ACTTACTCTGGGCACCTATAT pLKO_005 192 CDS 100% 13.200 9.240 N TSPAN7 n/a
3 TRCN0000379931 GTAAATGCCACACACCTTTAA pLKO_005 1233 3UTR 100% 13.200 9.240 N TSPAN7 n/a
4 TRCN0000379967 ACGCTATGCAGACTTACAATG pLKO_005 446 CDS 100% 10.800 7.560 N TSPAN7 n/a
5 TRCN0000118809 GCATGAACGAAACTGATTGTA pLKO.1 593 CDS 100% 5.625 3.938 N TSPAN7 n/a
6 TRCN0000118810 AGGGTTGTTATGATCTGGTAA pLKO.1 665 CDS 100% 4.950 3.465 N TSPAN7 n/a
7 TRCN0000118811 GCAGACTTACAATGGCAATGA pLKO.1 453 CDS 100% 4.950 3.465 N TSPAN7 n/a
8 TRCN0000118807 GCTTGTTACATACCTGGGTAT pLKO.1 1444 3UTR 100% 4.050 2.835 N TSPAN7 n/a
9 TRCN0000118808 GCCTGTTTGGATGCTTTGCTA pLKO.1 287 CDS 100% 3.000 2.100 N TSPAN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004615.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07076 pDONR223 100% 99.5% 98.7% None 115T>C;157G>A;379G>A n/a
2 ccsbBroad304_07076 pLX_304 0% 99.5% 98.7% V5 115T>C;157G>A;379G>A n/a
3 TRCN0000470352 TCTGACGCTTAAGACCTGATTCCT pLX_317 57.4% 99.5% 98.7% V5 115T>C;157G>A;379G>A n/a
Download CSV