Transcript: Human NM_004620.4

Homo sapiens TNF receptor associated factor 6 (TRAF6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
TRAF6 (7189)
Length:
7885
CDS:
248..1816

Additional Resources:

NCBI RefSeq record:
NM_004620.4
NBCI Gene record:
TRAF6 (7189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004620.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321253 AGCGCTGTGCAAACTATATAT pLKO_005 1449 CDS 100% 15.000 21.000 N Traf6 n/a
2 TRCN0000007348 GCCACGGGAAATATGTAATAT pLKO.1 1901 3UTR 100% 15.000 12.000 N TRAF6 n/a
3 TRCN0000007349 CGGAATTTCCAGGAAACTATT pLKO.1 1124 CDS 100% 13.200 10.560 N TRAF6 n/a
4 TRCN0000007350 CGAAGAGATAATGGATGCCAA pLKO.1 1585 CDS 100% 2.640 2.112 N TRAF6 n/a
5 TRCN0000356118 TATCTCAGAGGTCCGGAATTT pLKO_005 1111 CDS 100% 13.200 9.240 N TRAF6 n/a
6 TRCN0000356147 TCCAGACTCAAGAGTACTAAA pLKO_005 2139 3UTR 100% 13.200 9.240 N TRAF6 n/a
7 TRCN0000356146 TTAGAGAGGTCACTTACTATT pLKO_005 1938 3UTR 100% 13.200 9.240 N TRAF6 n/a
8 TRCN0000356117 TTCATAGTTTGAGCGTTATAC pLKO_005 1077 CDS 100% 13.200 9.240 N TRAF6 n/a
9 TRCN0000007352 CCTGGATTCTACACTGGCAAA pLKO.1 1379 CDS 100% 4.050 2.835 N TRAF6 n/a
10 TRCN0000007351 CCCATCTGCTTGATGGCATTA pLKO.1 458 CDS 100% 1.080 0.756 N TRAF6 n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 5335 3UTR 100% 4.950 2.475 Y NPHS1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4805 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4805 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004620.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10447 pDONR223 100% 99.8% 99.6% None 35C>T;1561delG n/a
2 ccsbBroad304_10447 pLX_304 0% 99.8% 99.6% V5 (not translated due to frame shift) 35C>T;1561delG n/a
3 TRCN0000468080 TCTTCATCCAGTACGCGATGTGTT pLX_317 23.7% 99.8% 99.6% V5 (not translated due to frame shift) 35C>T;1561delG n/a
Download CSV