Transcript: Human NM_004623.5

Homo sapiens tetratricopeptide repeat domain 4 (TTC4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TTC4 (7268)
Length:
2356
CDS:
49..1212

Additional Resources:

NCBI RefSeq record:
NM_004623.5
NBCI Gene record:
TTC4 (7268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004623.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218907 ATAGGATTCCAAGGCTTTAAA pLKO_005 1626 3UTR 100% 15.000 7.500 Y TTC4 n/a
2 TRCN0000230854 GAACAGGCCAAGACCTATAAA pLKO_005 277 CDS 100% 15.000 7.500 Y TTC4 n/a
3 TRCN0000144932 GCCACCTCAAAGCAATAATAA pLKO.1 494 CDS 100% 15.000 7.500 Y TTC4 n/a
4 TRCN0000145404 GCTTGTCTCCAGTCAATTATT pLKO.1 232 CDS 100% 15.000 7.500 Y TTC4 n/a
5 TRCN0000230853 GGCTTGTCTCCAGTCAATTAT pLKO_005 231 CDS 100% 15.000 7.500 Y TTC4 n/a
6 TRCN0000230855 ATGAGGGCAATGATTACTTTA pLKO_005 299 CDS 100% 13.200 6.600 Y TTC4 n/a
7 TRCN0000230856 CAGGTTTATTGATCATCTAAT pLKO_005 942 CDS 100% 13.200 6.600 Y TTC4 n/a
8 TRCN0000142803 CCACATCTTGCTCTGCATTTA pLKO.1 1742 3UTR 100% 13.200 6.600 Y TTC4 n/a
9 TRCN0000143823 GCACCAGAGGTACTTTGTAAA pLKO.1 1101 CDS 100% 13.200 6.600 Y TTC4 n/a
10 TRCN0000122779 GCCACATCTTGCTCTGCATTT pLKO.1 1741 3UTR 100% 10.800 5.400 Y TTC4 n/a
11 TRCN0000143131 CCTGGCCTCAAGTTATTTCAT pLKO.1 1657 3UTR 100% 5.625 2.813 Y TTC4 n/a
12 TRCN0000143132 CCATCTGGAACTGAAACACTT pLKO.1 528 CDS 100% 4.950 2.475 Y TTC4 n/a
13 TRCN0000144701 GCAATAATAAGAGGTGCCTTA pLKO.1 505 CDS 100% 4.050 2.025 Y TTC4 n/a
14 TRCN0000142535 GCACAGTACTATCTGGGCAAT pLKO.1 424 CDS 100% 4.050 2.025 Y TTC4 n/a
15 TRCN0000142556 GCTTCTGGAAATGAGGGCTAA pLKO.1 606 CDS 100% 4.050 2.025 Y TTC4 n/a
16 TRCN0000122196 GAAAGGTGTACCAGATACGAT pLKO.1 1190 CDS 100% 3.000 1.500 Y TTC4 n/a
17 TRCN0000142847 CCTGATTTGAATGCTGTCCTT pLKO.1 385 CDS 100% 2.640 1.320 Y TTC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004623.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07106 pDONR223 100% 99.9% 99.7% None 139T>A n/a
2 ccsbBroad304_07106 pLX_304 0% 99.9% 99.7% V5 139T>A n/a
3 TRCN0000473972 GGCACTCGGCTATTACTAGTGACG pLX_317 50.8% 99.9% 99.7% V5 139T>A n/a
Download CSV