Transcript: Human NM_004643.3

Homo sapiens poly(A) binding protein nuclear 1 (PABPN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PABPN1 (8106)
Length:
3118
CDS:
1283..2203

Additional Resources:

NCBI RefSeq record:
NM_004643.3
NBCI Gene record:
PABPN1 (8106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281945 ACCATACTGTGTGACAAATTT pLKO_005 1886 CDS 100% 15.000 7.500 Y PABPN1 n/a
2 TRCN0000272500 CCCAAAGGGTTTGCGTATATA pLKO_005 1916 CDS 100% 15.000 7.500 Y PABPN1 n/a
3 TRCN0000272447 CCTTAGATGAGTCCCTATTTA pLKO_005 1974 CDS 100% 15.000 7.500 Y PABPN1 n/a
4 TRCN0000000124 AGGTAGAGAAGCAGATGAATA pLKO.1 1707 CDS 100% 13.200 6.600 Y PABPN1 n/a
5 TRCN0000375066 GGTAGAGAAGCAGATGAATAT pLKO_005 1708 CDS 100% 13.200 6.600 Y Pabpn1 n/a
6 TRCN0000272502 CCAAACTGTTCTGCTTGTTAC pLKO_005 2584 3UTR 100% 10.800 5.400 Y PABPN1 n/a
7 TRCN0000272446 TAGAGCGACATCATGGTATTC pLKO_005 2173 CDS 100% 10.800 5.400 Y PABPN1 n/a
8 TRCN0000305879 TAGAGCGACATCATGGTATTC pLKO_005 2173 CDS 100% 10.800 5.400 Y Pabpn1 n/a
9 TRCN0000000122 GAGGTAGAGAAGCAGATGAAT pLKO.1 1706 CDS 100% 5.625 2.813 Y PABPN1 n/a
10 TRCN0000000121 CTCTCGATTCTACAGTGGTTT pLKO.1 2113 CDS 100% 4.950 2.475 Y PABPN1 n/a
11 TRCN0000102539 GTGGTTCAGTCAACCGTGTTA pLKO.1 1866 CDS 100% 4.950 2.475 Y Pabpn1 n/a
12 TRCN0000324929 GTGGTTCAGTCAACCGTGTTA pLKO_005 1866 CDS 100% 4.950 2.475 Y Pabpn1 n/a
13 TRCN0000000120 CCCATAACTAACTGCTGAGGA pLKO.1 2355 3UTR 100% 2.640 1.320 Y PABPN1 n/a
14 TRCN0000000123 CAGATGAATATGAGTCCACCT pLKO.1 1718 CDS 100% 2.160 1.080 Y PABPN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13989 pDONR223 100% 99.3% 99% None 3_8delGGCGGC n/a
2 ccsbBroad304_13989 pLX_304 0% 99.3% 99% V5 3_8delGGCGGC n/a
3 TRCN0000478024 TTGCGATAGGTCACGCTAGTCCTC pLX_317 50.8% 99.3% 99% V5 3_8delGGCGGC n/a
Download CSV