Transcript: Human NM_004666.3

Homo sapiens vanin 1 (VNN1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
VNN1 (8876)
Length:
3853
CDS:
21..1562

Additional Resources:

NCBI RefSeq record:
NM_004666.3
NBCI Gene record:
VNN1 (8876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373857 GGACTCTCTCTACCCATATTT pLKO_005 287 CDS 100% 15.000 21.000 N VNN1 n/a
2 TRCN0000178726 CCAAATGAAGTGTACGCTCTA pLKO.1 1140 CDS 100% 4.050 5.670 N VNN1 n/a
3 TRCN0000373856 CAGATCAGGGTGCGCATATTA pLKO_005 223 CDS 100% 15.000 12.000 N VNN1 n/a
4 TRCN0000183254 GCTGATGGATTGATAGTGAAA pLKO.1 2507 3UTR 100% 4.950 3.960 N VNN1 n/a
5 TRCN0000148050 GCACCTATTGTATGCTCATTA pLKO.1 1533 CDS 100% 13.200 9.240 N VNN1 n/a
6 TRCN0000373855 TATGAGCATGCAGCGATATTG pLKO_005 108 CDS 100% 13.200 9.240 N VNN1 n/a
7 TRCN0000182883 CCTGAGATTGTGACTTTCAAT pLKO.1 600 CDS 100% 5.625 3.938 N VNN1 n/a
8 TRCN0000146346 CCTCAGAATGTGACTGTATTT pLKO.1 2052 3UTR 100% 13.200 6.600 Y VNN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02038 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02038 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472960 GGAGTGAGCTGTTCACGGAAGAGA pLX_317 29.2% 100% 100% V5 n/a
4 ccsbBroadEn_02039 pDONR223 100% 100% 100% None n/a
5 TRCN0000478035 GACCCAACTTTGCGCTGGGCAACC pLX_317 28.8% 100% 100% V5 n/a
Download CSV