Transcript: Human NM_004788.4

Homo sapiens ubiquitination factor E4A (UBE4A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
UBE4A (9354)
Length:
6109
CDS:
117..3338

Additional Resources:

NCBI RefSeq record:
NM_004788.4
NBCI Gene record:
UBE4A (9354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004788.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007396 CCGGCCAAACACAGAACTAAA pLKO.1 3260 CDS 100% 13.200 18.480 N UBE4A n/a
2 TRCN0000279812 CCGGCCAAACACAGAACTAAA pLKO_005 3260 CDS 100% 13.200 18.480 N UBE4A n/a
3 TRCN0000007399 GCGCATCATCTCCATGTTGAA pLKO.1 2762 CDS 100% 4.950 6.930 N UBE4A n/a
4 TRCN0000007398 GCTCGCTTATTACTTCAAGAT pLKO.1 534 CDS 100% 4.950 6.930 N UBE4A n/a
5 TRCN0000279811 GCTCGCTTATTACTTCAAGAT pLKO_005 534 CDS 100% 4.950 6.930 N UBE4A n/a
6 TRCN0000007397 GCTGGGAGTAATTCTGAGTAT pLKO.1 1124 CDS 100% 4.950 6.930 N UBE4A n/a
7 TRCN0000279745 GCTGGGAGTAATTCTGAGTAT pLKO_005 1124 CDS 100% 4.950 6.930 N UBE4A n/a
8 TRCN0000007395 CCCTGCTATTTCTCTTCCAAT pLKO.1 3675 3UTR 100% 4.950 3.465 N UBE4A n/a
9 TRCN0000279746 CCCTGCTATTTCTCTTCCAAT pLKO_005 3675 3UTR 100% 4.950 3.465 N UBE4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004788.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11359 pDONR223 100% 99.3% 99.2% None 722_742del n/a
2 ccsbBroad304_11359 pLX_304 0% 99.3% 99.2% V5 722_742del n/a
3 TRCN0000479406 GGCAGAATCTGCAACGCAGCTGTA pLX_317 9.5% 99.3% 99.2% V5 722_742del n/a
Download CSV