Transcript: Human NM_004792.3

Homo sapiens peptidylprolyl isomerase G (PPIG), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PPIG (9360)
Length:
6357
CDS:
210..2474

Additional Resources:

NCBI RefSeq record:
NM_004792.3
NBCI Gene record:
PPIG (9360)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298654 AGCGGATGAGTGAGTTATATA pLKO_005 2466 CDS 100% 15.000 10.500 N PPIG n/a
2 TRCN0000293962 GGAGTAGAGAATGTGATATAA pLKO_005 1843 CDS 100% 15.000 10.500 N PPIG n/a
3 TRCN0000298653 ACGAAACCAACTCCTCATTTA pLKO_005 591 CDS 100% 13.200 9.240 N PPIG n/a
4 TRCN0000049325 CCAGAAGAGATCCCTCCTATA pLKO.1 1029 CDS 100% 10.800 7.560 N PPIG n/a
5 TRCN0000293963 CTTCCATTCTGTTTCGGATTT pLKO_005 2493 3UTR 100% 10.800 7.560 N PPIG n/a
6 TRCN0000049324 GCTGTTAAACACAACAAAGAA pLKO.1 510 CDS 100% 5.625 3.938 N PPIG n/a
7 TRCN0000049326 GCAGTCTGATTCTAAAGGAAA pLKO.1 1715 CDS 100% 4.950 3.465 N PPIG n/a
8 TRCN0000286507 GCAGTCTGATTCTAAAGGAAA pLKO_005 1715 CDS 100% 4.950 3.465 N PPIG n/a
9 TRCN0000049323 GCGAGAACTTTCGTTGTCTTT pLKO.1 319 CDS 100% 4.950 3.465 N PPIG n/a
10 TRCN0000049327 CCCTGGAACAGATGAAGACAA pLKO.1 2444 CDS 100% 4.950 2.970 N PPIG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11361 pDONR223 100% 97.9% 97.8% None 240_284del;1335T>A n/a
2 ccsbBroad304_11361 pLX_304 0% 97.9% 97.8% V5 240_284del;1335T>A n/a
3 TRCN0000480943 ATCACACGCGCCGTCGGAGTTCGT pLX_317 22.5% 97.9% 97.8% V5 240_284del;1335T>A n/a
4 ccsbBroadEn_11360 pDONR223 100% 46.5% 45.1% None (many diffs) n/a
5 ccsbBroad304_11360 pLX_304 0% 46.5% 45.1% V5 (many diffs) n/a
6 TRCN0000481264 TGTCATCAGGATTTCCTCACTCTA pLX_317 41.1% 46.5% 45.1% V5 (many diffs) n/a
Download CSV