Transcript: Human NM_004813.3

Homo sapiens peroxisomal biogenesis factor 16 (PEX16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PEX16 (9409)
Length:
1668
CDS:
67..1077

Additional Resources:

NCBI RefSeq record:
NM_004813.3
NBCI Gene record:
PEX16 (9409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323107 CACAAGGCCGCTCATGGATTA pLKO_005 1014 CDS 100% 10.800 15.120 N PEX16 n/a
2 TRCN0000118783 CCTACGGAAGGAGCTTCGGAA pLKO.1 258 CDS 100% 0.880 1.232 N PEX16 n/a
3 TRCN0000118784 GTCGTGGAAACCCTGGCTCTT pLKO.1 789 CDS 100% 1.350 1.080 N PEX16 n/a
4 TRCN0000323194 ACCTGCTTGTGCTGCTCAATG pLKO_005 230 CDS 100% 10.800 7.560 N PEX16 n/a
5 TRCN0000323192 TGCTGCGCTCTCCTTTCTATG pLKO_005 920 CDS 100% 10.800 7.560 N PEX16 n/a
6 TRCN0000323193 CCAAGAAGCCTTCACTAGGAG pLKO_005 1295 3UTR 100% 2.640 1.848 N PEX16 n/a
7 TRCN0000118785 TGGCAGGTCGATTCGCCGATT pLKO.1 173 CDS 100% 1.350 0.945 N PEX16 n/a
8 TRCN0000323119 ACCATCCTGCTGCTCTACTAC pLKO_005 898 CDS 100% 4.950 2.970 N PEX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07413 pDONR223 100% 99.9% 100% None 873T>C n/a
2 ccsbBroad304_07413 pLX_304 0% 99.9% 100% V5 873T>C n/a
3 TRCN0000465926 TTATATACAGTCTTATCATTAACC pLX_317 23.7% 99.9% 100% V5 873T>C n/a
Download CSV