Transcript: Human NM_004815.4

Homo sapiens Rho GTPase activating protein 29 (ARHGAP29), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ARHGAP29 (9411)
Length:
8952
CDS:
203..3988

Additional Resources:

NCBI RefSeq record:
NM_004815.4
NBCI Gene record:
ARHGAP29 (9411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004815.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426540 CCTTAAGTTCCAACTCTATTT pLKO_005 300 CDS 100% 13.200 18.480 N ARHGAP29 n/a
2 TRCN0000002151 CCAGTGTGATCTTACCCTTAA pLKO.1 1459 CDS 100% 10.800 8.640 N ARHGAP29 n/a
3 TRCN0000422937 TAAGATAGGTGGATTCGTATT pLKO_005 4227 3UTR 100% 10.800 8.640 N ARHGAP29 n/a
4 TRCN0000002152 CGGGTAGTAGATCATGCAGAA pLKO.1 2681 CDS 100% 4.050 3.240 N ARHGAP29 n/a
5 TRCN0000423081 TCGATTGTACAAGGAATTTAT pLKO_005 2473 CDS 100% 15.000 10.500 N ARHGAP29 n/a
6 TRCN0000002149 GCCTCACTGGAATTATCTTTA pLKO.1 4181 3UTR 100% 13.200 9.240 N ARHGAP29 n/a
7 TRCN0000002150 GCAGCTCTCACACACAAGTTT pLKO.1 2027 CDS 100% 5.625 3.938 N ARHGAP29 n/a
8 TRCN0000002153 GCTGGCTTTGTCATATGCTAA pLKO.1 820 CDS 100% 0.000 0.000 N ARHGAP29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004815.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14018 pDONR223 100% 30.8% 30.3% None (many diffs) n/a
2 ccsbBroad304_14018 pLX_304 0% 30.8% 30.3% V5 (many diffs) n/a
3 TRCN0000467083 CGCCGCCAACGAATGTACATCACT pLX_317 25.6% 30.8% 30.3% V5 (many diffs) n/a
Download CSV