Transcript: Human NM_004887.5

Homo sapiens C-X-C motif chemokine ligand 14 (CXCL14), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CXCL14 (9547)
Length:
1687
CDS:
214..513

Additional Resources:

NCBI RefSeq record:
NM_004887.5
NBCI Gene record:
CXCL14 (9547)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004887.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377839 ATTTGTCCATACGTCACTATA pLKO_005 832 3UTR 100% 13.200 18.480 N CXCL14 n/a
2 TRCN0000057924 CGACGTGAAGAAGCTGGAAAT pLKO.1 324 CDS 100% 10.800 8.640 N CXCL14 n/a
3 TRCN0000057925 CGAGGAGAAGATGGTTATCAT pLKO.1 366 CDS 100% 5.625 4.500 N CXCL14 n/a
4 TRCN0000377778 TGGACGGGTCCAAATGCAAGT pLKO_005 272 CDS 100% 4.050 3.240 N CXCL14 n/a
5 TRCN0000372013 CAAAGGACTTTGCAGATTAAA pLKO_005 563 3UTR 100% 15.000 10.500 N CXCL14 n/a
6 TRCN0000057926 GCGCAGGGTCTACGAAGAATA pLKO.1 492 CDS 100% 13.200 9.240 N CXCL14 n/a
7 TRCN0000065369 CTGCGAGGAGAAGATGGTTAT pLKO.1 363 CDS 100% 10.800 7.560 N Cxcl14 n/a
8 TRCN0000065372 GCTGGAAATGAAGCCAAAGTA pLKO.1 336 CDS 100% 5.625 3.938 N Cxcl14 n/a
9 TRCN0000057923 GCGCTTCATCAAGTGGTACAA pLKO.1 456 CDS 100% 4.950 3.465 N CXCL14 n/a
10 TRCN0000057927 GATCCGCTACAGCGACGTGAA pLKO.1 312 CDS 100% 1.350 0.945 N CXCL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004887.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02194 pDONR223 100% 89.1% 89.1% None 0_1ins36 n/a
2 ccsbBroad304_02194 pLX_304 0% 89.1% 89.1% V5 0_1ins36 n/a
3 TRCN0000478372 TCAGTGTATGGAGTGATTCGCTGT pLX_317 90% 89.1% 89.1% V5 0_1ins36 n/a
Download CSV