Transcript: Human NM_004911.5

Homo sapiens protein disulfide isomerase family A member 4 (PDIA4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PDIA4 (9601)
Length:
2767
CDS:
98..2035

Additional Resources:

NCBI RefSeq record:
NM_004911.5
NBCI Gene record:
PDIA4 (9601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004911.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049334 CCTGAGAGAAGATTACAAATT pLKO.1 1084 CDS 100% 13.200 18.480 N PDIA4 n/a
2 TRCN0000289674 CCTGAGAGAAGATTACAAATT pLKO_005 1084 CDS 100% 13.200 18.480 N PDIA4 n/a
3 TRCN0000049336 GCAAGGTGTCAAACGATGCTA pLKO.1 1296 CDS 100% 3.000 4.200 N PDIA4 n/a
4 TRCN0000307107 GCAAGGTGTCAAACGATGCTA pLKO_005 1296 CDS 100% 3.000 4.200 N PDIA4 n/a
5 TRCN0000049337 CTTGGTCCTAAATGATGCAAA pLKO.1 289 CDS 100% 4.950 3.465 N PDIA4 n/a
6 TRCN0000289676 CTTGGTCCTAAATGATGCAAA pLKO_005 289 CDS 100% 4.950 3.465 N PDIA4 n/a
7 TRCN0000111779 GCTAACAACCTGAGAGAAGAT pLKO.1 1076 CDS 100% 4.950 3.465 N Pdia4 n/a
8 TRCN0000316228 GCTAACAACCTGAGAGAAGAT pLKO_005 1076 CDS 100% 4.950 3.465 N Pdia4 n/a
9 TRCN0000049335 CCAAGAAGTACAAGGGCCAAA pLKO.1 1803 CDS 100% 4.050 2.835 N PDIA4 n/a
10 TRCN0000049333 GCTTGTGTTGACCAAAGAGAA pLKO.1 634 CDS 100% 4.950 2.970 N PDIA4 n/a
11 TRCN0000289675 GCTTGTGTTGACCAAAGAGAA pLKO_005 634 CDS 100% 4.950 2.970 N PDIA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004911.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02208 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02208 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466550 TCCGAAGTCGGTAGATTGACGGCG pLX_317 15.7% 100% 100% V5 n/a
Download CSV