Transcript: Human NM_004943.2

Homo sapiens DM1 locus, WD repeat containing (DMWD), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DMWD (1762)
Length:
3410
CDS:
90..2114

Additional Resources:

NCBI RefSeq record:
NM_004943.2
NBCI Gene record:
DMWD (1762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164235 CGAGGGTTTCTACAAGCTACT pLKO.1 176 CDS 100% 4.050 5.670 N DMWD n/a
2 TRCN0000159551 CCGAAATGTTTCTGTTTCTAA pLKO.1 3138 3UTR 100% 5.625 3.938 N DMWD n/a
3 TRCN0000162751 CCTCAACAAGCCAATTGACAA pLKO.1 539 CDS 100% 4.950 3.465 N DMWD n/a
4 TRCN0000162351 CATTGACCTCAACAAGCCAAT pLKO.1 533 CDS 100% 4.050 2.835 N DMWD n/a
5 TRCN0000161945 GATTTCAACCAGTTCACTGCT pLKO.1 594 CDS 100% 2.640 1.848 N DMWD n/a
6 TRCN0000164328 CAAGCCAATTGACAAGCGGAT pLKO.1 545 CDS 100% 2.160 1.512 N DMWD n/a
7 TRCN0000164014 CGTGAGCTCTATTTCTACCCA pLKO.1 483 CDS 100% 0.750 0.525 N DMWD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10782 pDONR223 100% 49.5% 49.5% None 1_945del;1362C>G;1902_1976del n/a
2 ccsbBroad304_10782 pLX_304 0% 49.5% 49.5% V5 1_945del;1362C>G;1902_1976del n/a
3 TRCN0000473830 ACATCAGTACCCCCGCAGATCGTC pLX_317 43.1% 49.5% 49.5% V5 1_945del;1362C>G;1902_1976del n/a
Download CSV