Transcript: Human NM_004978.5

Homo sapiens potassium voltage-gated channel subfamily C member 4 (KCNC4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
KCNC4 (3749)
Length:
19909
CDS:
1187..3094

Additional Resources:

NCBI RefSeq record:
NM_004978.5
NBCI Gene record:
KCNC4 (3749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004978.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044941 CGTCGGAGAAGATCATCATCA pLKO.1 1287 CDS 100% 4.950 6.930 N KCNC4 n/a
2 TRCN0000044942 GACTCTAAGCAGAATGGCGAT pLKO.1 2801 CDS 100% 2.160 3.024 N KCNC4 n/a
3 TRCN0000044940 GAGACCCATGAGGCCTTTAAT pLKO.1 1922 CDS 100% 15.000 10.500 N KCNC4 n/a
4 TRCN0000431850 AGTGTCCGGAAAGGCACATTC pLKO_005 2993 CDS 100% 10.800 7.560 N KCNC4 n/a
5 TRCN0000420126 CACGCTGGACTTCGTCAAGAA pLKO_005 2101 CDS 100% 4.950 3.465 N KCNC4 n/a
6 TRCN0000044938 GAGGGTATGATCGAGAGGAAA pLKO.1 2774 CDS 100% 4.950 3.465 N KCNC4 n/a
7 TRCN0000069035 GTCGGAGAAGATCATCATCAA pLKO.1 1288 CDS 100% 4.950 3.465 N Kcnc4 n/a
8 TRCN0000069034 GAAGGCAATGTTGAGCCGAAA pLKO.1 3633 3UTR 100% 4.050 2.835 N Kcnc4 n/a
9 TRCN0000044939 CCAATGAGTTCCTGCTGCTTA pLKO.1 2319 CDS 100% 4.950 2.970 N KCNC4 n/a
10 TRCN0000073773 CCTCTCAAGTAGCTGGGACTA pLKO.1 18459 3UTR 100% 4.050 2.025 Y TINAGL1 n/a
11 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 14396 3UTR 100% 2.640 1.320 Y Gm4169 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 18593 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 18464 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 18593 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004978.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488393 CCCAGCTCGCCGCAGATGCAGCCA pLX_317 18.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000487938 CACTCCCCATTACGCCACTCGACG pLX_317 16.8% 99.9% 99.8% V5 1905_1906insG n/a
3 ccsbBroadEn_10931 pDONR223 100% 88.5% 82.7% None (many diffs) n/a
4 ccsbBroad304_10931 pLX_304 0% 88.5% 82.7% V5 (many diffs) n/a
5 TRCN0000477692 ATGTGGAAGGGACAAGAACCGTAC pLX_317 23.5% 88.5% 82.7% V5 (many diffs) n/a
Download CSV