Transcript: Human NM_005069.6

Homo sapiens SIM bHLH transcription factor 2 (SIM2), transcript variant SIM2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SIM2 (6493)
Length:
4461
CDS:
633..2636

Additional Resources:

NCBI RefSeq record:
NM_005069.6
NBCI Gene record:
SIM2 (6493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005069.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015152 CGGGCAACAGTATTTATGAAT pLKO.1 991 CDS 100% 5.625 7.875 N SIM2 n/a
2 TRCN0000015148 GCTTCATTATTACGTGGCAAA pLKO.1 3430 3UTR 100% 4.050 5.670 N SIM2 n/a
3 TRCN0000015151 GCCTTGTCTACCTCACAAGAA pLKO.1 1707 CDS 100% 0.495 0.693 N SIM2 n/a
4 TRCN0000429100 ACGACTCCTGCTACCAGATTG pLKO_005 1234 CDS 100% 10.800 7.560 N SIM2 n/a
5 TRCN0000422875 AGATAGAGAGGTCGTTCTTTC pLKO_005 1096 CDS 100% 10.800 7.560 N SIM2 n/a
6 TRCN0000015149 CCTGATCGAGAAGACCCTATA pLKO.1 1409 CDS 100% 10.800 7.560 N SIM2 n/a
7 TRCN0000015150 GCTGCAGACTTTGGATGGATT pLKO.1 884 CDS 100% 4.950 3.465 N SIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005069.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01536 pDONR223 100% 83% 77.8% None (many diffs) n/a
2 ccsbBroad304_01536 pLX_304 0% 83% 77.8% V5 (many diffs) n/a
3 TRCN0000472671 CTCCGTTCCATTCTTGTAGTAACT pLX_317 23.3% 83% 77.8% V5 (many diffs) n/a
Download CSV