Transcript: Human NM_005073.4

Homo sapiens solute carrier family 15 member 1 (SLC15A1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC15A1 (6564)
Length:
3124
CDS:
75..2201

Additional Resources:

NCBI RefSeq record:
NM_005073.4
NBCI Gene record:
SLC15A1 (6564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043301 CGCCACAATGTCAACCTAATT pLKO.1 1681 CDS 100% 13.200 18.480 N SLC15A1 n/a
2 TRCN0000043299 GCGGAGATCGAAGCTCAATTT pLKO.1 2100 CDS 100% 13.200 18.480 N SLC15A1 n/a
3 TRCN0000043302 GCTCTTGAAATTCAGCCCGAT pLKO.1 1023 CDS 100% 2.160 3.024 N SLC15A1 n/a
4 TRCN0000043298 GCGGCTCATCTCCCAAATTAA pLKO.1 887 CDS 100% 15.000 10.500 N SLC15A1 n/a
5 TRCN0000043300 GCTGGGAAAGTTCAAGACCAT pLKO.1 305 CDS 100% 2.640 1.584 N SLC15A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005073.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06967 pDONR223 100% 99.9% 99.8% None 952C>G;1347T>C n/a
2 ccsbBroad304_06967 pLX_304 0% 99.9% 99.8% V5 952C>G;1347T>C n/a
3 TRCN0000471681 AACAGATAGCAAAAAACGACCTCT pLX_317 19.6% 99.9% 99.8% V5 952C>G;1347T>C n/a
Download CSV