Transcript: Human NM_005110.4

Homo sapiens glutamine-fructose-6-phosphate transaminase 2 (GFPT2), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
GFPT2 (9945)
Length:
3034
CDS:
120..2168

Additional Resources:

NCBI RefSeq record:
NM_005110.4
NBCI Gene record:
GFPT2 (9945)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005110.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310819 AGGTAACTTCAGTGCGTTTAT pLKO_005 1076 CDS 100% 13.200 18.480 N GFPT2 n/a
2 TRCN0000304114 GCCCGTCATCATGGTCATTAT pLKO_005 1883 CDS 100% 13.200 18.480 N GFPT2 n/a
3 TRCN0000031676 GCTACGAGTTTGAGTCAGAAA pLKO.1 529 CDS 100% 4.950 6.930 N Gfpt2 n/a
4 TRCN0000288122 GCTACGAGTTTGAGTCAGAAA pLKO_005 529 CDS 100% 4.950 6.930 N Gfpt2 n/a
5 TRCN0000075226 CGATACTGAAAGTTCCAAGTT pLKO.1 1991 CDS 100% 4.950 3.960 N GFPT2 n/a
6 TRCN0000295408 ACCATCGCCAAGCTGATTAAA pLKO_005 561 CDS 100% 15.000 10.500 N Gfpt2 n/a
7 TRCN0000304174 ACCATCGCCAAGCTGATTAAA pLKO_005 561 CDS 100% 15.000 10.500 N GFPT2 n/a
8 TRCN0000304176 ATCCGTGGCTTGAGATCTTTA pLKO_005 1641 CDS 100% 13.200 9.240 N GFPT2 n/a
9 TRCN0000075223 CCAGAGGAGAAGGGAATCATT pLKO.1 2365 3UTR 100% 5.625 3.938 N GFPT2 n/a
10 TRCN0000300712 CCAGAGGAGAAGGGAATCATT pLKO_005 2365 3UTR 100% 5.625 3.938 N GFPT2 n/a
11 TRCN0000075225 CCGAGGATATGACGTTGACTT pLKO.1 2111 CDS 100% 4.950 3.465 N GFPT2 n/a
12 TRCN0000075224 GCTCAGACAAAGGCAACGAAT pLKO.1 442 CDS 100% 4.950 2.970 N GFPT2 n/a
13 TRCN0000075227 CTCAGACAAAGGCAACGAATT pLKO.1 443 CDS 100% 0.000 0.000 N GFPT2 n/a
14 TRCN0000048331 CTGCTGTCCTTCCACCTGGAT pLKO.1 2085 CDS 100% 0.880 0.440 Y CDC42EP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005110.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07515 pDONR223 100% 99.9% 99.8% None 1411A>G;1908T>C n/a
2 ccsbBroad304_07515 pLX_304 0% 99.9% 99.8% V5 1411A>G;1908T>C n/a
3 TRCN0000475849 AACATACTTGAACTCCCCCTCGAC pLX_317 16.2% 99.9% 99.8% V5 1411A>G;1908T>C n/a
Download CSV