Transcript: Human NM_005143.5

Homo sapiens haptoglobin (HP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HP (3240)
Length:
1534
CDS:
149..1369

Additional Resources:

NCBI RefSeq record:
NM_005143.5
NBCI Gene record:
HP (3240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005143.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372395 GGTATGCGACTGGGATCTTAA pLKO_005 1254 CDS 100% 13.200 18.480 N HP n/a
2 TRCN0000083017 GACCAATGCATAAGGCATTAT pLKO.1 1067 CDS 100% 1.320 1.848 N HP n/a
3 TRCN0000083014 CCTTAAACAATGAGAAGCAGT pLKO.1 525 CDS 100% 2.640 1.848 N HP n/a
4 TRCN0000378718 TCCTGAATGTGAAGCAGATGA pLKO_005 397 CDS 100% 4.950 2.970 N HP n/a
5 TRCN0000083016 CCAGTGTAAGAACTACTACAA pLKO.1 298 CDS 100% 4.950 2.475 Y HP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005143.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06397 pDONR223 100% 99.5% 99.5% None (many diffs) n/a
2 ccsbBroad304_06397 pLX_304 0% 99.5% 99.5% V5 (many diffs) n/a
3 TRCN0000469493 TTGTTTACTGACTTTAGCTCAGGC pLX_317 35.1% 99.5% 99.5% V5 (many diffs) n/a
Download CSV