Transcript: Human NM_005215.4

Homo sapiens DCC netrin 1 receptor (DCC), mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
DCC (1630)
Length:
10181
CDS:
592..4935

Additional Resources:

NCBI RefSeq record:
NM_005215.4
NBCI Gene record:
DCC (1630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221570 GCAGCATACCAATTACCCATA pLKO.1 4978 3UTR 100% 4.050 5.670 N DCC n/a
2 TRCN0000221571 GCGAGGTTATATTATCGGTTA pLKO.1 2856 CDS 100% 4.050 5.670 N DCC n/a
3 TRCN0000221574 GCGTCTCTACTGATGATATAA pLKO.1 2411 CDS 100% 15.000 10.500 N DCC n/a
4 TRCN0000010319 CATCTCAGCCTGAGCATTCTA pLKO.1 4535 CDS 100% 5.625 3.938 N DCC n/a
5 TRCN0000221572 CCCAGTTGATTATTATCCTTT pLKO.1 3057 CDS 100% 4.950 3.465 N DCC n/a
6 TRCN0000221573 CCATCCAATGTAGTAGCCATT pLKO.1 1327 CDS 100% 4.050 2.835 N DCC n/a
7 TRCN0000010320 CAGTTCAGAAGGAATAAGCAT pLKO.1 5079 3UTR 100% 3.000 2.100 N DCC n/a
8 TRCN0000010318 TACTCAAGTGTGAAGTCATTG pLKO.1 1064 CDS 100% 10.800 6.480 N DCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.