Transcript: Human NM_005247.4

Homo sapiens fibroblast growth factor 3 (FGF3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FGF3 (2248)
Length:
1540
CDS:
484..1203

Additional Resources:

NCBI RefSeq record:
NM_005247.4
NBCI Gene record:
FGF3 (2248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430247 GTCTGGGTTCTCAGCTATTTC pLKO_005 1303 3UTR 100% 13.200 18.480 N FGF3 n/a
2 TRCN0000038159 ACTCTATGCTTCGGAGCACTA pLKO.1 795 CDS 100% 4.050 5.670 N FGF3 n/a
3 TRCN0000424974 TCACGTTCAGGCTTCGAGACT pLKO_005 1152 CDS 100% 2.640 3.696 N FGF3 n/a
4 TRCN0000038160 GAGCTGGGCTATAATACGTAT pLKO.1 850 CDS 100% 4.950 3.960 N FGF3 n/a
5 TRCN0000425240 AGAGACTGTGGTACGTGTCTG pLKO_005 932 CDS 100% 4.050 2.835 N FGF3 n/a
6 TRCN0000038163 CACACAGAAGTCCTCCCTGTT pLKO.1 996 CDS 100% 4.050 2.835 N FGF3 n/a
7 TRCN0000038162 CAAGCTCTACTGCGCCACGAA pLKO.1 621 CDS 100% 0.880 0.616 N FGF3 n/a
8 TRCN0000038161 CGGCAGAAGCAGAGCCCGGAT pLKO.1 1117 CDS 100% 0.000 0.000 N FGF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00556 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00556 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477770 CTCGTAGTGACCCAGATACCACTC pLX_317 55.8% 100% 100% V5 n/a
Download CSV