Transcript: Human NM_005250.3

Homo sapiens forkhead box L1 (FOXL1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
FOXL1 (2300)
Length:
4930
CDS:
176..1213

Additional Resources:

NCBI RefSeq record:
NM_005250.3
NBCI Gene record:
FOXL1 (2300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430049 GAGCAGCTACGGAGACTTAAA pLKO_005 1412 3UTR 100% 13.200 9.240 N FOXL1 n/a
2 TRCN0000416411 GTGGGTTCAGGGAAGTGTTAC pLKO_005 1325 3UTR 100% 10.800 7.560 N FOXL1 n/a
3 TRCN0000013978 CTGCCTGGACATGTTTGAGAA pLKO.1 559 CDS 100% 4.950 3.465 N FOXL1 n/a
4 TRCN0000422720 CCTTTCAACGCTTCCCTGATG pLKO_005 1094 CDS 100% 4.050 2.835 N FOXL1 n/a
5 TRCN0000013981 CCAAGAGCTTCAGCATAGACA pLKO.1 948 CDS 100% 3.000 2.100 N FOXL1 n/a
6 TRCN0000013980 CTCTCCGAAGAGCTCCGACAA pLKO.1 925 CDS 100% 1.350 0.945 N FOXL1 n/a
7 TRCN0000013979 CCCATGCTGTATCTGTACGGT pLKO.1 221 CDS 100% 0.750 0.525 N FOXL1 n/a
8 TRCN0000013982 CGGCATCTACCAGTTCATCAT pLKO.1 394 CDS 100% 4.950 2.475 Y FOXL1 n/a
9 TRCN0000017867 GCAGAACAGCATCCGCCACAA pLKO.1 454 CDS 100% 1.350 0.675 Y FOXD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.