Transcript: Human NM_005253.4

Homo sapiens FOS like 2, AP-1 transcription factor subunit (FOSL2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
FOSL2 (2355)
Length:
6713
CDS:
864..1844

Additional Resources:

NCBI RefSeq record:
NM_005253.4
NBCI Gene record:
FOSL2 (2355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329711 GCAGAAATTCCGGGTAGATAT pLKO_005 962 CDS 100% 13.200 18.480 N FOSL2 n/a
2 TRCN0000016139 CAGCAGAAATTCCGGGTAGAT pLKO.1 960 CDS 100% 4.950 3.465 N FOSL2 n/a
3 TRCN0000016138 GCAGTGAGTATTGGAAGACTT pLKO.1 1997 3UTR 100% 4.950 3.465 N FOSL2 n/a
4 TRCN0000329710 GCAGTGAGTATTGGAAGACTT pLKO_005 1997 3UTR 100% 4.950 3.465 N FOSL2 n/a
5 TRCN0000016141 CACCTCCATGTCCAACCCATA pLKO.1 1070 CDS 100% 4.050 2.835 N FOSL2 n/a
6 TRCN0000016142 CACGGCCCAGTGTGCAAGATT pLKO.1 1422 CDS 100% 1.875 1.313 N FOSL2 n/a
7 TRCN0000329767 CACGGCCCAGTGTGCAAGATT pLKO_005 1422 CDS 100% 1.875 1.313 N FOSL2 n/a
8 TRCN0000016140 GCGCTCTGTCATCAAGCCCAT pLKO.1 1589 CDS 100% 0.720 0.504 N FOSL2 n/a
9 TRCN0000353569 GCGCTCTGTCATCAAGCCCAT pLKO_005 1589 CDS 100% 0.720 0.504 N FOSL2 n/a
10 TRCN0000263186 GTGATCACCTCCATGTCCAAT pLKO_005 1065 CDS 100% 4.950 3.960 N Fosl2 n/a
11 TRCN0000225639 TGATCACCTCCATGTCCAATC pLKO_005 1066 CDS 100% 6.000 4.200 N LOC634417 n/a
12 TRCN0000282515 GTCATCAAGCCCATCAGCATC pLKO_005 1596 CDS 100% 4.050 2.835 N Fosl2 n/a
13 TRCN0000240238 TCAGATTTCAAGCTGTGTTTG pLKO_005 4176 3UTR 100% 10.800 6.480 N Ssxb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00587 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00587 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472210 TTCATCCTCTCAACCTCCAGTACC pLX_317 47.7% 100% 100% V5 n/a
Download CSV