Transcript: Human NM_005302.5

Homo sapiens G protein-coupled receptor 37 (GPR37), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
GPR37 (2861)
Length:
5298
CDS:
817..2658

Additional Resources:

NCBI RefSeq record:
NM_005302.5
NBCI Gene record:
GPR37 (2861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005302.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008895 CCGGCAGAAAGGTGCATTATT pLKO.1 2059 CDS 100% 15.000 21.000 N GPR37 n/a
2 TRCN0000357221 CAGTACCATACGCCGTGAAAT pLKO_005 2604 CDS 100% 13.200 18.480 N GPR37 n/a
3 TRCN0000357170 TGCGAGACTGTGGTGGTATTT pLKO_005 2136 CDS 100% 13.200 18.480 N GPR37 n/a
4 TRCN0000008894 CGTACAGATGTACTACGAAAT pLKO.1 1911 CDS 100% 10.800 15.120 N GPR37 n/a
5 TRCN0000357220 TGCAAGATCGTGCCCTATATA pLKO_005 1816 CDS 100% 15.000 10.500 N GPR37 n/a
6 TRCN0000008892 CTTGGAAGCATTCACAAAGTA pLKO.1 3073 3UTR 100% 5.625 3.938 N GPR37 n/a
7 TRCN0000008896 CGAGGGAATAAACGGCAGATT pLKO.1 2248 CDS 100% 4.950 3.465 N GPR37 n/a
8 TRCN0000008893 CCTTAATATCATCAGCCAGTT pLKO.1 2403 CDS 100% 4.050 2.835 N GPR37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005302.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00678 pDONR223 100% 99.9% 100% None 1047T>C n/a
2 ccsbBroad304_00678 pLX_304 0% 99.9% 100% V5 1047T>C n/a
3 TRCN0000488195 TGAGTATTCCGCTTTGTCAGACGC pLX_317 19.3% 99.8% 100% V5 (not translated due to prior stop codon) 1047T>C;1329G>C n/a
4 TRCN0000488307 GCCATACTTTACCACACTCAATGC pLX_317 15.4% 99.8% 99.8% V5 1047T>C;1329G>C;1839_1840insG n/a
Download CSV