Transcript: Human NM_005322.2

Homo sapiens H1.5 linker histone, cluster member (H1-5), mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H1-5 (3009)
Length:
790
CDS:
53..733

Additional Resources:

NCBI RefSeq record:
NM_005322.2
NBCI Gene record:
H1-5 (3009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106806 AGGAGCGCAATGGCCTTTCTT pLKO.1 216 CDS 100% 5.625 7.875 N H1-5 n/a
2 TRCN0000444370 AGTTAAGCCGAAGGCGGCAAA pLKO_005 637 CDS 100% 4.050 5.670 N H1-5 n/a
3 TRCN0000106805 CCGGCTAAGAAGAAGGCAACT pLKO.1 107 CDS 100% 4.050 5.670 N H1-5 n/a
4 TRCN0000106807 GCCCAAGGCAGTTAAGCCGAA pLKO.1 628 CDS 100% 0.720 1.008 N H1-5 n/a
5 TRCN0000439146 AGACTCCGAAGAAGGCGAAGA pLKO_005 513 CDS 100% 4.050 2.835 N H1-5 n/a
6 TRCN0000106808 GCAGTGAAGAAGACTCCGAAG pLKO.1 503 CDS 100% 2.250 1.575 N H1-5 n/a
7 TRCN0000415536 AGAAGGCAACTAAGAAGGCTG pLKO_005 117 CDS 100% 2.160 1.512 N H1-5 n/a
8 TRCN0000106809 GAGAAGAATAACAGCCGCATT pLKO.1 281 CDS 100% 4.050 2.025 Y H1-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00715 pDONR223 100% 74.6% 83.7% None (many diffs) n/a
2 TRCN0000467159 AGTATACGATAATTTCTCCAAAAA pLX_317 57.5% 74.6% 83.7% V5 (many diffs) n/a
3 ccsbBroad304_00715 pLX_304 76.1% 74.5% 83.7% V5 (many diffs) n/a
Download CSV