Transcript: Human NM_005435.4

Homo sapiens Rho guanine nucleotide exchange factor 5 (ARHGEF5), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ARHGEF5 (7984)
Length:
5482
CDS:
113..4906

Additional Resources:

NCBI RefSeq record:
NM_005435.4
NBCI Gene record:
ARHGEF5 (7984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005435.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182881 CAGATGATAGAGCAGGTTAAT pLKO.1 890 CDS 100% 13.200 6.600 Y ARHGEF35 n/a
2 TRCN0000029747 GCAGAGACCAACCAGAATGAA pLKO.1 683 CDS 100% 5.625 2.813 Y ARHGEF5 n/a
3 TRCN0000147119 CAGGACTTACTTCTTTGACAT pLKO.1 573 CDS 100% 4.950 2.475 Y ARHGEF35 n/a
4 TRCN0000029746 CCTGACAAGGAAATAGATCAA pLKO.1 1535 CDS 100% 4.950 2.475 Y ARHGEF5 n/a
5 TRCN0000029748 CTCTCAAGAATCCATCTCAAA pLKO.1 2128 CDS 100% 4.950 2.475 Y ARHGEF5 n/a
6 TRCN0000179458 GAAGAGGAGAATGAGCATCAT pLKO.1 1301 CDS 100% 4.950 2.475 Y ARHGEF35 n/a
7 TRCN0000029745 GCAACATGACAAACTTCCTAT pLKO.1 2889 CDS 100% 4.950 2.475 Y ARHGEF5 n/a
8 TRCN0000029744 GCAATAACAATGTCCAGAGTA pLKO.1 4176 CDS 100% 4.950 2.475 Y ARHGEF5 n/a
9 TRCN0000180869 GCAACTCAGCAGAGTGAGTTA pLKO.1 284 CDS 100% 0.495 0.248 Y ARHGEF35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005435.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05689 pDONR223 100% 29.9% 29.5% None (many diffs) n/a
2 ccsbBroad304_05689 pLX_304 0% 29.9% 29.5% V5 (many diffs) n/a
3 TRCN0000477723 TTCCTAATGGTCCGGTCATACCCC pLX_317 25.7% 29.9% 29.5% V5 (many diffs) n/a
Download CSV