Transcript: Human NM_005498.5

Homo sapiens adaptor related protein complex 1 subunit mu 2 (AP1M2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
AP1M2 (10053)
Length:
1748
CDS:
82..1353

Additional Resources:

NCBI RefSeq record:
NM_005498.5
NBCI Gene record:
AP1M2 (10053)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005498.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139259 CGGAGAGAAACGTCGTGATTT pLKO.1 1088 CDS 100% 13.200 18.480 N AP1M2 n/a
2 TRCN0000139521 CCAGGTCCGATACATGAAGAT pLKO.1 1251 CDS 100% 4.950 6.930 N AP1M2 n/a
3 TRCN0000141189 CGCAGCAAGAACAAATCAGTA pLKO.1 754 CDS 100% 4.950 6.930 N AP1M2 n/a
4 TRCN0000145247 GAGGTCTTCATTGATGTCATA pLKO.1 589 CDS 100% 4.950 6.930 N AP1M2 n/a
5 TRCN0000144267 CAATAGAGGTATTCTGCGAAT pLKO.1 341 CDS 100% 4.050 5.670 N AP1M2 n/a
6 TRCN0000141187 CATGAGCAAGATTGAGCACTT pLKO.1 159 CDS 100% 4.050 5.670 N AP1M2 n/a
7 TRCN0000141067 CCACTTCCTATGGATCAAACA pLKO.1 246 CDS 100% 4.950 3.960 N AP1M2 n/a
8 TRCN0000141188 CGAGGTCTTCATTGATGTCAT pLKO.1 588 CDS 100% 4.950 3.960 N AP1M2 n/a
9 TRCN0000141113 CTTCCTCACCTCTTCCTTATT pLKO.1 1497 3UTR 100% 13.200 9.240 N AP1M2 n/a
10 TRCN0000141736 GATCTGGATTGAGTCTGTCAT pLKO.1 909 CDS 100% 4.950 3.465 N AP1M2 n/a
11 TRCN0000139492 CCGCAGCAAGAACAAATCAGT pLKO.1 753 CDS 100% 3.000 2.100 N AP1M2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005498.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15691 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15691 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_15690 pDONR223 0% 99.9% 100% None 615A>G n/a
4 ccsbBroad304_15690 pLX_304 0% 99.9% 100% V5 615A>G n/a
5 TRCN0000466644 ACGGATCAATCGAGATTTTAAATA pLX_317 29.7% 99.7% 99.5% V5 615A>G;1258C>T;1264A>C n/a
6 ccsbBroadEn_11451 pDONR223 100% 99.3% 99% None 615A>G;673_674insTTTCAG;1090A>C n/a
7 ccsbBroad304_11451 pLX_304 0% 99.3% 99% V5 615A>G;673_674insTTTCAG;1090A>C n/a
8 TRCN0000481528 GATAGCTTACGACTACCTGCTATG pLX_317 33.2% 99.3% 99% V5 615A>G;673_674insTTTCAG;1090A>C n/a
Download CSV