Transcript: Human NM_005572.3

Homo sapiens lamin A/C (LMNA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
LMNA (4000)
Length:
2077
CDS:
250..1968

Additional Resources:

NCBI RefSeq record:
NM_005572.3
NBCI Gene record:
LMNA (4000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061836 CATGGGCAATTGGCAGATCAA pLKO.1 1638 CDS 100% 4.950 3.960 N LMNA n/a
2 TRCN0000281518 CTGCGCAACAAGTCCAATGAG pLKO_005 1609 CDS 100% 4.950 3.960 N LMNA n/a
3 TRCN0000262764 AGAAGGAGGGTGACCTGATAG pLKO_005 614 CDS 100% 10.800 7.560 N LMNA n/a
4 TRCN0000262765 ATTCTGCCAAGCTGGACAATG pLKO_005 1049 CDS 100% 10.800 7.560 N LMNA n/a
5 TRCN0000262697 GATGATCCCTTGCTGACTTAC pLKO_005 1672 CDS 100% 10.800 7.560 N LMNA n/a
6 TRCN0000262766 ACCAGGTGGAGCAGTATAAGA pLKO_005 1010 CDS 100% 5.625 3.938 N LMNA n/a
7 TRCN0000282379 ATGATCGCTTGGCGGTCTACA pLKO_005 365 CDS 100% 4.950 3.465 N LMNA n/a
8 TRCN0000061833 CGACTGGTGGAGATTGACAAT pLKO.1 922 CDS 100% 4.950 3.465 N LMNA n/a
9 TRCN0000061834 CCCACCAAAGTTCACCCTGAA pLKO.1 1698 CDS 100% 4.050 2.835 N LMNA n/a
10 TRCN0000061837 GCCGTGCTTCCTCTCACTCAT pLKO.1 1448 CDS 100% 1.650 1.155 N LMNA n/a
11 TRCN0000061835 GAAGCAACTTCAGGATGAGAT pLKO.1 789 CDS 100% 4.950 2.970 N LMNA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00945 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00945 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479914 TCCACCGTTCTGGCCTTAGTTCCT pLX_317 26.4% 100% 100% V5 n/a
4 ccsbBroadEn_00946 pDONR223 100% 85.9% 85.2% None (many diffs) n/a
5 ccsbBroad304_00946 pLX_304 0% 85.9% 85.2% V5 (many diffs) n/a
6 TRCN0000478811 ACAATGAGTGTACATAATTTCCGT pLX_317 22.1% 85.9% 85.2% V5 (many diffs) n/a
Download CSV