Transcript: Human NM_005573.4

Homo sapiens lamin B1 (LMNB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
LMNB1 (4001)
Length:
2890
CDS:
374..2134

Additional Resources:

NCBI RefSeq record:
NM_005573.4
NBCI Gene record:
LMNB1 (4001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005573.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029269 CCAGGGAAGAACTGATGGAAA pLKO.1 1239 CDS 100% 4.950 3.465 N LMNB1 n/a
2 TRCN0000278590 CCAGGGAAGAACTGATGGAAA pLKO_005 1239 CDS 100% 4.950 3.465 N LMNB1 n/a
3 TRCN0000029273 CCCAGATCAAGCTTCGAGAAT pLKO.1 765 CDS 100% 4.950 3.465 N LMNB1 n/a
4 TRCN0000297155 CCCAGATCAAGCTTCGAGAAT pLKO_005 765 CDS 100% 4.950 3.465 N LMNB1 n/a
5 TRCN0000029270 CGCTTGAAGAACACTTCTGAA pLKO.1 1736 CDS 100% 4.950 3.465 N LMNB1 n/a
6 TRCN0000297205 CGCTTGAAGAACACTTCTGAA pLKO_005 1736 CDS 100% 4.950 3.465 N LMNB1 n/a
7 TRCN0000029271 GCATGAGAATTGAGAGCCTTT pLKO.1 1263 CDS 100% 4.050 2.835 N LMNB1 n/a
8 TRCN0000297206 GCATGAGAATTGAGAGCCTTT pLKO_005 1263 CDS 100% 4.050 2.835 N LMNB1 n/a
9 TRCN0000029272 GCTCAAAGAAGTACAGTCTTT pLKO.1 1991 CDS 100% 0.495 0.347 N LMNB1 n/a
10 TRCN0000297156 GCTCAAAGAAGTACAGTCTTT pLKO_005 1991 CDS 100% 0.495 0.347 N LMNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005573.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06529 pDONR223 100% 99.9% 99.8% None 1144G>C n/a
2 ccsbBroad304_06529 pLX_304 0% 99.9% 99.8% V5 1144G>C n/a
3 TRCN0000467310 ACTAATTTTCTAGTCCGAAAAGTC pLX_317 23% 99.9% 99.8% V5 1144G>C n/a
Download CSV