Transcript: Human NM_005606.7

Homo sapiens legumain (LGMN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LGMN (5641)
Length:
1980
CDS:
169..1470

Additional Resources:

NCBI RefSeq record:
NM_005606.7
NBCI Gene record:
LGMN (5641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005606.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029254 GCCGGATAACATCAATGTTTA pLKO.1 762 CDS 100% 13.200 18.480 N LGMN n/a
2 TRCN0000029255 CGCCTGTTACTATGATGAGAA pLKO.1 819 CDS 100% 4.950 6.930 N LGMN n/a
3 TRCN0000276308 CGCCTGTTACTATGATGAGAA pLKO_005 819 CDS 100% 4.950 6.930 N LGMN n/a
4 TRCN0000029258 CCACGTCATGCAGTATGGAAA pLKO.1 963 CDS 100% 4.950 3.960 N LGMN n/a
5 TRCN0000276301 GTATTGAGAAGGGTCATATTT pLKO_005 1693 3UTR 100% 15.000 10.500 N LGMN n/a
6 TRCN0000276300 AGGTTCAAATGGCTGGTATAA pLKO_005 273 CDS 100% 13.200 9.240 N LGMN n/a
7 TRCN0000276299 GCCATGCCTACCAGATCATTC pLKO_005 317 CDS 100% 10.800 7.560 N LGMN n/a
8 TRCN0000029257 CATTGCTTACTCTGAAGACAA pLKO.1 387 CDS 100% 4.950 3.465 N LGMN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005606.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06783 pDONR223 100% 99.7% 99.7% None 52G>A;720T>C;1251G>A n/a
2 ccsbBroad304_06783 pLX_304 0% 99.7% 99.7% V5 52G>A;720T>C;1251G>A n/a
3 TRCN0000478208 AGGTCAAGAGCCTGGGTCCTGATC pLX_317 21.2% 99.7% 99.7% V5 52G>A;720T>C;1251G>A n/a
Download CSV