Transcript: Human NM_005637.3

Homo sapiens SS18 subunit of BAF chromatin remodeling complex (SS18), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SS18 (6760)
Length:
3347
CDS:
79..1242

Additional Resources:

NCBI RefSeq record:
NM_005637.3
NBCI Gene record:
SS18 (6760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119079 GAAGGCATGAACCAGCAATAT pLKO.1 928 CDS 100% 13.200 10.560 N SS18 n/a
2 TRCN0000119080 CCTGGACCCAATCAACTCAAT pLKO.1 490 CDS 100% 4.950 3.960 N SS18 n/a
3 TRCN0000359419 GGGAATGATGGGTCAAGTTAA pLKO_005 774 CDS 100% 13.200 9.240 N SS18 n/a
4 TRCN0000119078 GTCAGCAGTATGGAGGATATA pLKO.1 1136 CDS 100% 13.200 9.240 N SS18 n/a
5 TRCN0000359495 GATGCCTGGGCCTAACCATAT pLKO_005 456 CDS 100% 10.800 7.560 N SS18 n/a
6 TRCN0000359497 TGGTATACCTTGCTACAATAG pLKO_005 251 CDS 100% 10.800 7.560 N SS18 n/a
7 TRCN0000119077 CCTCCTTCTCAGCAATACAAT pLKO.1 706 CDS 100% 5.625 3.938 N SS18 n/a
8 TRCN0000108564 CCATGAATATGCCTTCAAGTA pLKO.1 524 CDS 100% 4.950 3.465 N Ss18 n/a
9 TRCN0000316422 CCATGAATATGCCTTCAAGTA pLKO_005 524 CDS 100% 4.950 3.465 N Ss18 n/a
10 TRCN0000119081 GCAGATGTTGCACACAAACTT pLKO.1 231 CDS 100% 5.625 3.375 N SS18 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 3111 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07004 pDONR223 100% 92.5% 92.3% None 239C>T;879_880ins93 n/a
2 ccsbBroad304_07004 pLX_304 0% 92.5% 92.3% V5 239C>T;879_880ins93 n/a
3 TRCN0000467495 TCTGGGGAAACTTTGTTATGCGTC pLX_317 30.5% 92.5% 92.3% V5 239C>T;879_880ins93 n/a
Download CSV