Transcript: Human NM_005654.6

Homo sapiens nuclear receptor subfamily 2 group F member 1 (NR2F1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NR2F1 (7025)
Length:
3843
CDS:
1803..3074

Additional Resources:

NCBI RefSeq record:
NM_005654.6
NBCI Gene record:
NR2F1 (7025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005654.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021739 CGTCCGCAGGAACTTAACTTA pLKO.1 2141 CDS 100% 5.625 7.875 N NR2F1 n/a
2 TRCN0000350649 GTCCGCAGGAACTTAACTTAC pLKO_005 2142 CDS 100% 10.800 7.560 N NR2F1 n/a
3 TRCN0000021740 CAGCTTCAACTGGCCTTACAT pLKO.1 3035 CDS 100% 5.625 3.938 N NR2F1 n/a
4 TRCN0000322965 CAGCTTCAACTGGCCTTACAT pLKO_005 3035 CDS 100% 5.625 3.938 N NR2F1 n/a
5 TRCN0000322966 ATCGTGCTGTTCACGTCAGAC pLKO_005 2775 CDS 100% 4.050 2.835 N NR2F1 n/a
6 TRCN0000021742 CTCTTCTTCGTCCGTTTGGTA pLKO.1 2964 CDS 100% 3.000 2.100 N NR2F1 n/a
7 TRCN0000323042 CTCTTCTTCGTCCGTTTGGTA pLKO_005 2964 CDS 100% 3.000 2.100 N NR2F1 n/a
8 TRCN0000021743 GCCCAACAACATTATGGGCAT pLKO.1 2429 CDS 100% 0.216 0.151 N NR2F1 n/a
9 TRCN0000021741 CCAGCCCAATCCAGGCCAGTA pLKO.1 2294 CDS 100% 0.000 0.000 N NR2F1 n/a
10 TRCN0000322963 CCAGCCCAATCCAGGCCAGTA pLKO_005 2294 CDS 100% 0.000 0.000 N NR2F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005654.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492178 TACGTTGGACATGGCCCACATCTG pLX_317 10.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489296 AGCCGAGAAACCGAAGATGCCCTT pLX_317 17.3% 99.7% 99.7% V5 12A>C;114C>A;1269_1270insG n/a
Download CSV