Transcript: Human NM_005669.5

Homo sapiens receptor accessory protein 5 (REEP5), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
REEP5 (7905)
Length:
3008
CDS:
38..607

Additional Resources:

NCBI RefSeq record:
NM_005669.5
NBCI Gene record:
REEP5 (7905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005669.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117839 GCGAAGAAAGCTACCGTGAAT pLKO.1 557 CDS 100% 4.950 6.930 N REEP5 n/a
2 TRCN0000300828 GCGAAGAAAGCTACCGTGAAT pLKO_005 557 CDS 100% 4.950 6.930 N REEP5 n/a
3 TRCN0000117841 CGGCGTGAACAGGAGCTTCAT pLKO.1 127 CDS 100% 1.650 2.310 N REEP5 n/a
4 TRCN0000300829 CGGCGTGAACAGGAGCTTCAT pLKO_005 127 CDS 100% 1.650 2.310 N REEP5 n/a
5 TRCN0000117838 CCAGCCTACATCTCAATTAAA pLKO.1 236 CDS 100% 15.000 10.500 N REEP5 n/a
6 TRCN0000300827 CCAGCCTACATCTCAATTAAA pLKO_005 236 CDS 100% 15.000 10.500 N REEP5 n/a
7 TRCN0000117840 TGCCATCACTAAAGAAGCGAA pLKO.1 541 CDS 100% 2.640 1.848 N REEP5 n/a
8 TRCN0000300753 TGCCATCACTAAAGAAGCGAA pLKO_005 541 CDS 100% 2.640 1.848 N REEP5 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1372 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005669.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11247 pDONR223 100% 97.8% 97.8% None 1_12del n/a
2 ccsbBroad304_11247 pLX_304 0% 97.8% 97.8% V5 1_12del n/a
3 TRCN0000468254 TCGACGGACATGGGAAAGATCAAC pLX_317 67.1% 97.8% 97.8% V5 1_12del n/a
Download CSV