Transcript: Human NM_005682.7

Homo sapiens adhesion G protein-coupled receptor G1 (ADGRG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ADGRG1 (9289)
Length:
4311
CDS:
245..2326

Additional Resources:

NCBI RefSeq record:
NM_005682.7
NBCI Gene record:
ADGRG1 (9289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005682.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011618 CCTGGTGTTTCTGTTCAACAT pLKO.1 1981 CDS 100% 4.950 3.960 N ADGRG1 n/a
2 TRCN0000318767 CCTGGTGTTTCTGTTCAACAT pLKO_005 1981 CDS 100% 4.950 3.960 N ADGRG1 n/a
3 TRCN0000011616 CCATCATCTTGGCTGTGCATA pLKO.1 1875 CDS 100% 4.950 3.465 N ADGRG1 n/a
4 TRCN0000318766 CCATCATCTTGGCTGTGCATA pLKO_005 1875 CDS 100% 4.950 3.465 N ADGRG1 n/a
5 TRCN0000011619 GACTTCTTGCTGAGTGACAAA pLKO.1 569 CDS 100% 4.950 3.465 N ADGRG1 n/a
6 TRCN0000318831 GACTTCTTGCTGAGTGACAAA pLKO_005 569 CDS 100% 4.950 3.465 N ADGRG1 n/a
7 TRCN0000011617 CCAAACATCCTGCTTCTGCAA pLKO.1 1363 CDS 100% 2.640 1.848 N ADGRG1 n/a
8 TRCN0000011615 GCGTTCAATCTTGACCTTGAA pLKO.1 3608 3UTR 100% 0.495 0.248 Y ADGRG1 n/a
9 TRCN0000318833 GCGTTCAATCTTGACCTTGAA pLKO_005 3608 3UTR 100% 0.495 0.248 Y ADGRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005682.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488567 GCGGGTATGAATTTGCGGAATCGC pLX_317 17.2% 99.9% 99.8% V5 (not translated due to prior stop codon) 918A>C;996T>C n/a
2 ccsbBroadEn_07386 pDONR223 100% 99.8% 99.7% None 7C>G;918A>C;996T>C n/a
3 ccsbBroad304_07386 pLX_304 0% 99.8% 99.7% V5 7C>G;918A>C;996T>C n/a
4 TRCN0000474803 GTCACGATCCTTAGGTTTGCCGGT pLX_317 16.7% 99.8% 99.7% V5 7C>G;918A>C;996T>C n/a
Download CSV