Transcript: Human NM_005692.4

Homo sapiens ABCF2-H2B readthrough (LOC114483834), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
LOC114483834 (114483834)
Length:
2405
CDS:
255..2159

Additional Resources:

NCBI RefSeq record:
NM_005692.4
NBCI Gene record:
LOC114483834 (114483834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005692.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000298682 AGATCCCTCCACCTGTCATTA pLKO_005 1423 CDS 100% 13.200 6.600 Y ABCF2 n/a
2 TRCN0000298683 GGGCGTTACCATCAGCATTTA pLKO_005 1641 CDS 100% 13.200 6.600 Y ABCF2 n/a
3 TRCN0000294030 CGTTATGGCCTCATTGGTTTA pLKO_005 591 CDS 100% 10.800 5.400 Y ABCF2 n/a
4 TRCN0000294031 CGTTTGTAAACGACGTGTTTG pLKO_005 2172 3UTR 100% 10.800 5.400 Y ABCF2 n/a
5 TRCN0000059335 CCTTGCATCTACAATAATCTA pLKO.1 1482 CDS 100% 5.625 2.813 Y ABCF2 n/a
6 TRCN0000286605 CCTTGCATCTACAATAATCTA pLKO_005 1482 CDS 100% 5.625 2.813 Y ABCF2 n/a
7 TRCN0000059333 GCACACATGAAGAACTACATT pLKO.1 1260 CDS 100% 5.625 2.813 Y ABCF2 n/a
8 TRCN0000096948 CCAAGGCTGTCACCAAGTACA pLKO.1 2325 3UTR 100% 4.950 2.475 Y Hist1h2be n/a
9 TRCN0000059336 CCTCTTTATTCGGCCCTTCAT pLKO.1 980 CDS 100% 4.950 2.475 Y ABCF2 n/a
10 TRCN0000438590 CAAGGCTGTCACCAAGTACAC pLKO_005 2326 3UTR 100% 4.050 2.025 Y H2BU1 n/a
11 TRCN0000059334 CCAGAGATCAAGGAGAAGGAA pLKO.1 1716 CDS 100% 3.000 1.500 Y ABCF2 n/a
12 TRCN0000059337 CCCTTGCATTGTGTGATGGAA pLKO.1 726 CDS 100% 3.000 1.500 Y ABCF2 n/a
13 TRCN0000096945 CACCAAGTACACCAGCTCCAA pLKO.1 2335 3UTR 100% 2.640 1.320 Y Hist1h2be n/a
14 TRCN0000096978 GCATCATGAACTCGTTTGTGA pLKO.1 2160 CDS 100% 3.000 1.500 Y Hist1h2bf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005692.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07542 pDONR223 100% 98.1% 98.2% None 279T>C;939C>T;1870_1902del n/a
2 ccsbBroad304_07542 pLX_304 0% 98.1% 98.2% V5 279T>C;939C>T;1870_1902del n/a
3 TRCN0000472258 GACCTTAATTGACCACTTCTTTTA pLX_317 16.9% 98.1% 98.2% V5 279T>C;939C>T;1870_1902del n/a
Download CSV