Transcript: Human NM_005704.5

Homo sapiens protein tyrosine phosphatase receptor type U (PTPRU), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PTPRU (10076)
Length:
5603
CDS:
124..4464

Additional Resources:

NCBI RefSeq record:
NM_005704.5
NBCI Gene record:
PTPRU (10076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005704.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230436 CGAAGCCTGAGATGGTCTATG pLKO_005 3014 CDS 100% 10.800 15.120 N PTPRU n/a
2 TRCN0000230435 TGACGCGTTGCCACACCTATA pLKO_005 1355 CDS 100% 10.800 15.120 N PTPRU n/a
3 TRCN0000356100 GTACTGGGACTTGGCATTTAG pLKO_005 4903 3UTR 100% 13.200 10.560 N PTPRU n/a
4 TRCN0000218274 CATTGATCCTCAGAGTAATTC pLKO_005 3621 CDS 100% 13.200 9.240 N PTPRU n/a
5 TRCN0000230437 GAACCAGGATCTGCCTATTAC pLKO_005 5116 3UTR 100% 13.200 9.240 N PTPRU n/a
6 TRCN0000220110 CAGCTTTGATTATGCCGACAT pLKO.1 1893 CDS 100% 4.050 2.835 N PTPRU n/a
7 TRCN0000220109 CTGTGTGGAATATGACTGGAT pLKO.1 515 CDS 100% 2.640 1.848 N PTPRU n/a
8 TRCN0000356099 CCTCATGGAGGTGGAGTTTAT pLKO_005 4026 CDS 100% 13.200 7.920 N PTPRU n/a
9 TRCN0000220111 CCGGAACTACAAACCCAACAT pLKO.1 4368 CDS 100% 4.950 2.970 N PTPRU n/a
10 TRCN0000220108 ACGTGCTCTCTGAATGCCAAA pLKO.1 5585 3UTR 100% 4.050 2.835 N PTPRU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005704.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07547 pDONR223 100% 99% 99.1% None (many diffs) n/a
2 ccsbBroad304_07547 pLX_304 0% 99% 99.1% V5 (many diffs) n/a
Download CSV