Transcript: Human NM_005736.4

Homo sapiens actin related protein 1A (ACTR1A), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ACTR1A (10121)
Length:
2830
CDS:
66..1196

Additional Resources:

NCBI RefSeq record:
NM_005736.4
NBCI Gene record:
ACTR1A (10121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005736.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353696 CAACGGATCCGGTGTGATTAA pLKO_005 110 CDS 100% 13.200 18.480 N ACTR1A n/a
2 TRCN0000116550 AGAGCCTGTTACCTATCCATA pLKO.1 723 CDS 100% 4.950 6.930 N ACTR1A n/a
3 TRCN0000116548 CGGTGTGATTAAAGCTGGTTT pLKO.1 119 CDS 100% 4.950 6.930 N ACTR1A n/a
4 TRCN0000116549 CGTCAAGGATTGGAACGACAT pLKO.1 302 CDS 100% 4.050 5.670 N ACTR1A n/a
5 TRCN0000116547 GCCTTGCTACACTAATGTTTA pLKO.1 2026 3UTR 100% 13.200 10.560 N ACTR1A n/a
6 TRCN0000330730 TCCTGACTGAGGCGCCTTTAA pLKO_005 391 CDS 100% 13.200 10.560 N ACTR1A n/a
7 TRCN0000330729 TGAAGTTAACTCCACTTTAAA pLKO_005 1224 3UTR 100% 15.000 10.500 N ACTR1A n/a
8 TRCN0000116551 AGCCTGTTACCTATCCATAAA pLKO.1 725 CDS 100% 13.200 9.240 N ACTR1A n/a
9 TRCN0000330802 TGAGATTGTCAAGGCCATAAA pLKO_005 698 CDS 100% 13.200 9.240 N ACTR1A n/a
10 TRCN0000330803 GAGCCTGTTACCTATCCATAA pLKO_005 724 CDS 100% 10.800 7.560 N ACTR1A n/a
11 TRCN0000374697 GAGATTGTCAAGGCCATAAAG pLKO_005 699 CDS 100% 13.200 9.240 N Actr1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005736.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02320 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02320 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465939 CCTATTAGCTTAATGCGATACTAC pLX_317 33.4% 100% 100% V5 n/a
4 ccsbBroadEn_07555 pDONR223 100% 79.6% 90.4% None (many diffs) n/a
5 ccsbBroad304_07555 pLX_304 0% 79.6% 90.4% V5 (many diffs) n/a
6 TRCN0000465969 GCCACCGGCCCCGTCGATTCAGTA pLX_317 38.1% 79.6% 90.4% V5 (many diffs) n/a
7 ccsbBroadEn_07554 pDONR223 100% 79.5% 90.1% None (many diffs) n/a
8 ccsbBroad304_07554 pLX_304 0% 79.5% 90.1% V5 (many diffs) n/a
9 TRCN0000471351 ATAATAAATACATTTACAGATCGA pLX_317 45.1% 79.5% 90.1% V5 (many diffs) n/a
Download CSV