Transcript: Human NM_005796.3

Homo sapiens nuclear transport factor 2 (NUTF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NUTF2 (10204)
Length:
2120
CDS:
83..466

Additional Resources:

NCBI RefSeq record:
NM_005796.3
NBCI Gene record:
NUTF2 (10204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038552 GAACCCAACTAGGCGCAATTT pLKO.1 159 CDS 100% 13.200 18.480 N NUTF2 n/a
2 TRCN0000300236 GAACCCAACTAGGCGCAATTT pLKO_005 159 CDS 100% 13.200 18.480 N NUTF2 n/a
3 TRCN0000038549 CCACCAGATGTTCCTATTAAA pLKO.1 379 CDS 100% 15.000 12.000 N NUTF2 n/a
4 TRCN0000300169 CCACCAGATGTTCCTATTAAA pLKO_005 379 CDS 100% 15.000 12.000 N NUTF2 n/a
5 TRCN0000444405 TCAATGCCTCATGATACAATA pLKO_005 826 3UTR 100% 13.200 9.240 N Nutf2 n/a
6 TRCN0000038553 GATGCTTGGGTTTGCACCAAT pLKO.1 410 CDS 100% 4.950 3.465 N NUTF2 n/a
7 TRCN0000333495 GATGCTTGGGTTTGCACCAAT pLKO_005 410 CDS 100% 4.950 3.465 N NUTF2 n/a
8 TRCN0000038550 ACATCAACGATGCTTGGGTTT pLKO.1 402 CDS 100% 4.050 2.835 N NUTF2 n/a
9 TRCN0000333504 ACATCAACGATGCTTGGGTTT pLKO_005 402 CDS 100% 4.050 2.835 N NUTF2 n/a
10 TRCN0000038551 AGATAGCTGCATCATCAGCAT pLKO.1 313 CDS 100% 2.640 1.848 N NUTF2 n/a
11 TRCN0000333562 AGATAGCTGCATCATCAGCAT pLKO_005 313 CDS 100% 2.640 1.848 N NUTF2 n/a
12 TRCN0000188940 GTGGAGAAGTTGTCTAGCCTT pLKO.1 239 CDS 100% 2.640 1.848 N NUTF2P4 n/a
13 TRCN0000079796 CCCAACTAGGCGCAATTTATA pLKO.1 162 CDS 100% 15.000 12.000 N Nutf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005796.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02352 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02352 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471183 GCCTTTTACTTTGTGCATCCCTAC pLX_317 98.5% 100% 100% V5 n/a
Download CSV