Transcript: Human NM_005921.2

Homo sapiens mitogen-activated protein kinase kinase kinase 1 (MAP3K1), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K1 (4214)
Length:
7036
CDS:
26..4564

Additional Resources:

NCBI RefSeq record:
NM_005921.2
NBCI Gene record:
MAP3K1 (4214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196442 GACCCACAGTTGACCTTTATT pLKO.1 5086 3UTR 100% 15.000 21.000 N MAP3K1 n/a
2 TRCN0000197225 GCCACAGTTTAGCGGAAAGAA pLKO.1 2025 CDS 100% 5.625 7.875 N MAP3K1 n/a
3 TRCN0000350517 GCCACAGTTTAGCGGAAAGAA pLKO_005 2025 CDS 100% 5.625 7.875 N MAP3K1 n/a
4 TRCN0000006160 GCCTTTCGTATCTCCATGAAA pLKO.1 4092 CDS 100% 5.625 7.875 N MAP3K1 n/a
5 TRCN0000315395 ATCTCATCATTCCCAATTAAT pLKO_005 2941 CDS 100% 15.000 10.500 N MAP3K1 n/a
6 TRCN0000196286 GCTCATTTGCTGAGTAAATAT pLKO.1 4019 CDS 100% 15.000 10.500 N MAP3K1 n/a
7 TRCN0000350518 TGAAGTTTGCATGACTAAATT pLKO_005 4821 3UTR 100% 15.000 10.500 N MAP3K1 n/a
8 TRCN0000006162 CGGTCGTGAGATGGAGAATAA pLKO.1 505 CDS 100% 13.200 9.240 N MAP3K1 n/a
9 TRCN0000195000 CTGGAAATTGTATCGTGTAAT pLKO.1 6622 3UTR 100% 13.200 9.240 N MAP3K1 n/a
10 TRCN0000196318 GATGTGGCTCTTCGTTGTTTA pLKO.1 4472 CDS 100% 13.200 9.240 N MAP3K1 n/a
11 TRCN0000006159 GCCTGTTGAAATCAGGTATAA pLKO.1 2380 CDS 100% 13.200 9.240 N MAP3K1 n/a
12 TRCN0000196823 GCAATTACAATCTCTTCATTG pLKO.1 3975 CDS 100% 10.800 7.560 N MAP3K1 n/a
13 TRCN0000315434 GGCGTAGCTCAAGGATCAAAG pLKO_005 1209 CDS 100% 10.800 7.560 N MAP3K1 n/a
14 TRCN0000196615 GTAGCAGCAATAGTAGTAATG pLKO.1 3315 CDS 100% 10.800 7.560 N MAP3K1 n/a
15 TRCN0000006161 CCTCTCCTTTATCTCATCATT pLKO.1 2931 CDS 100% 5.625 3.938 N MAP3K1 n/a
16 TRCN0000006158 CCACTCTTATTGTGCAGGTTA pLKO.1 5389 3UTR 100% 4.950 3.465 N MAP3K1 n/a
17 TRCN0000025182 CCAGTAACATACACAGGCCAA pLKO.1 3186 CDS 100% 2.160 1.512 N Map3k1 n/a
18 TRCN0000193184 CAACAACAACAACAACAGAAA pLKO.1 2856 CDS 100% 4.950 2.475 Y Dclre1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.