Transcript: Human NM_005932.4

Homo sapiens mitochondrial intermediate peptidase (MIPEP), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MIPEP (4285)
Length:
2381
CDS:
81..2222

Additional Resources:

NCBI RefSeq record:
NM_005932.4
NBCI Gene record:
MIPEP (4285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431849 GTGCGAGAAGCTGCTTATAAA pLKO_005 867 CDS 100% 15.000 21.000 N MIPEP n/a
2 TRCN0000046787 CTTCTGTTGATGACTTCGTAA pLKO.1 2143 CDS 100% 4.950 6.930 N MIPEP n/a
3 TRCN0000046784 GCAAATGATTATCGAGTAGTT pLKO.1 1680 CDS 100% 4.950 6.930 N MIPEP n/a
4 TRCN0000046783 CCCAACAAGATTGAGAAGCAT pLKO.1 756 CDS 100% 3.000 2.400 N MIPEP n/a
5 TRCN0000046786 GCTGGTCAATTGAAATGTTTA pLKO.1 906 CDS 100% 13.200 9.240 N MIPEP n/a
6 TRCN0000425999 GGGTATGGTGCTAGATATTAC pLKO_005 1959 CDS 100% 13.200 9.240 N MIPEP n/a
7 TRCN0000046785 CCACAGACATTCTCAAGGAAA pLKO.1 1867 CDS 100% 4.950 3.465 N MIPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01016 pDONR223 100% 99.9% 99.8% None 1462A>G n/a
2 ccsbBroad304_01016 pLX_304 0% 99.9% 99.8% V5 1462A>G n/a
3 TRCN0000480179 TTTATCCGATTCACCGTGTAGATG pLX_317 17.6% 99.9% 99.8% V5 1462A>G n/a
Download CSV