Transcript: Human NM_005993.5

Homo sapiens tubulin folding cofactor D (TBCD), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TBCD (6904)
Length:
7159
CDS:
130..3708

Additional Resources:

NCBI RefSeq record:
NM_005993.5
NBCI Gene record:
TBCD (6904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005993.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303636 CACAAATGTGCTTCCTATAAA pLKO_005 3914 3UTR 100% 15.000 21.000 N TBCD n/a
2 TRCN0000117358 CCGCGTAATAATGGACAAATA pLKO.1 309 CDS 100% 13.200 18.480 N TBCD n/a
3 TRCN0000117361 GCTCTATGATCGTCAGTTATA pLKO.1 2112 CDS 100% 13.200 18.480 N TBCD n/a
4 TRCN0000299472 GCTCTATGATCGTCAGTTATA pLKO_005 2112 CDS 100% 13.200 18.480 N TBCD n/a
5 TRCN0000117359 CCGTAATTGATGGTTGGCAAT pLKO.1 2222 CDS 100% 4.050 5.670 N TBCD n/a
6 TRCN0000299471 CCGTAATTGATGGTTGGCAAT pLKO_005 2222 CDS 100% 4.050 5.670 N TBCD n/a
7 TRCN0000117360 CGGTAACAGATCCAACTGTTT pLKO.1 1746 CDS 100% 0.495 0.693 N TBCD n/a
8 TRCN0000331648 CGGTAACAGATCCAACTGTTT pLKO_005 1746 CDS 100% 0.495 0.693 N TBCD n/a
9 TRCN0000303637 ACCAAGGTTCGAGGCTATAAA pLKO_005 457 CDS 100% 15.000 12.000 N TBCD n/a
10 TRCN0000369697 TTTGACCACAGCTGACTATTT pLKO_005 1719 CDS 100% 13.200 9.240 N TBCD n/a
11 TRCN0000117357 CCAGTCTTGGAGAGAGATGAA pLKO.1 4124 3UTR 100% 4.950 2.970 N TBCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005993.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15605 pDONR223 0% 62.8% 59.6% None 30C>T;2123_2307del;2436_3576del n/a
2 ccsbBroad304_15605 pLX_304 0% 62.8% 59.6% V5 30C>T;2123_2307del;2436_3576del n/a
3 ccsbBroadEn_15606 pDONR223 0% 52.1% 52% None (many diffs) n/a
4 ccsbBroad304_15606 pLX_304 0% 52.1% 52% V5 (many diffs) n/a
Download CSV