Transcript: Human NM_006011.4

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 (ST8SIA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ST8SIA2 (8128)
Length:
5655
CDS:
185..1312

Additional Resources:

NCBI RefSeq record:
NM_006011.4
NBCI Gene record:
ST8SIA2 (8128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035255 CCAGTCAAGTACCACTATTAT pLKO.1 1160 CDS 100% 15.000 10.500 N ST8SIA2 n/a
2 TRCN0000035254 GCCTGGAGATATTATTCATTA pLKO.1 538 CDS 100% 13.200 9.240 N ST8SIA2 n/a
3 TRCN0000035258 GCTGTTGTTGACAGAAGTAAT pLKO.1 380 CDS 100% 13.200 9.240 N ST8SIA2 n/a
4 TRCN0000035257 CAGCTTACATAGCAAATCTAA pLKO.1 322 CDS 100% 5.625 3.938 N ST8SIA2 n/a
5 TRCN0000035256 CCACACGTTTCTGCAAACAAA pLKO.1 1092 CDS 100% 5.625 3.938 N ST8SIA2 n/a
6 TRCN0000110384 GCAGACATCTCAGAGATCGAA pLKO.1 251 CDS 100% 3.000 2.100 N St8sia2 n/a
7 TRCN0000110383 GCCTCAAGTATGGCTACACTT pLKO.1 1185 CDS 100% 4.950 3.465 N St8sia2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006011.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07203 pDONR223 100% 99.8% 99.7% None 621C>G;1033C>G n/a
2 ccsbBroad304_07203 pLX_304 0% 99.8% 99.7% V5 621C>G;1033C>G n/a
3 TRCN0000465774 CCGCGAGTGGATACGCACCAGCGC pLX_317 27.2% 99.8% 99.7% V5 621C>G;1033C>G n/a
Download CSV