Transcript: Human NM_006097.5

Homo sapiens myosin light chain 9 (MYL9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MYL9 (10398)
Length:
2786
CDS:
70..588

Additional Resources:

NCBI RefSeq record:
NM_006097.5
NBCI Gene record:
MYL9 (10398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006097.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053504 CGCCAAGGATAAAGACGACTA pLKO.1 567 CDS 100% 4.050 5.670 N MYL9 n/a
2 TRCN0000300033 CGCCAAGGATAAAGACGACTA pLKO_005 567 CDS 100% 4.050 5.670 N MYL9 n/a
3 TRCN0000053506 GATGTGATTCGCAACGCCTTT pLKO.1 370 CDS 100% 4.050 5.670 N MYL9 n/a
4 TRCN0000300035 GATGTGATTCGCAACGCCTTT pLKO_005 370 CDS 100% 4.050 5.670 N MYL9 n/a
5 TRCN0000053505 CATTGATAAGAAAGGCAACTT pLKO.1 510 CDS 100% 4.950 3.465 N MYL9 n/a
6 TRCN0000300034 CATTGATAAGAAAGGCAACTT pLKO_005 510 CDS 100% 4.950 3.465 N MYL9 n/a
7 TRCN0000053503 CCACATCCAATGTCTTCGCAA pLKO.1 122 CDS 100% 2.640 1.848 N MYL9 n/a
8 TRCN0000300032 CCACATCCAATGTCTTCGCAA pLKO_005 122 CDS 100% 2.640 1.848 N MYL9 n/a
9 TRCN0000053507 CGACGAGGAAGCCTCAGGTTT pLKO.1 399 CDS 100% 1.650 1.155 N MYL9 n/a
10 TRCN0000104569 ACCATGTTCCTCACCATGTTT pLKO.1 319 CDS 100% 5.625 2.813 Y Myl12a n/a
11 TRCN0000316527 ACCATGTTCCTCACCATGTTT pLKO_005 319 CDS 100% 5.625 2.813 Y Myl12a n/a
12 TRCN0000054101 CCCATCAACTTCACCATGTTT pLKO.1 307 CDS 100% 5.625 2.813 Y MYL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006097.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04625 pDONR223 100% 81% 93% None (many diffs) n/a
2 ccsbBroad304_04625 pLX_304 0% 81% 93% V5 (many diffs) n/a
3 TRCN0000471311 TCCGAATTTCTGATTGCTTCCGAT pLX_317 98.8% 81% 93% V5 (many diffs) n/a
4 ccsbBroadEn_15721 pDONR223 0% 78.3% 93% None (many diffs) n/a
5 ccsbBroad304_15721 pLX_304 0% 78.3% 93% V5 (many diffs) n/a
6 TRCN0000472404 GCCAATTATATCATGCGGCATTGC pLX_317 74.2% 77.9% 91.8% V5 (many diffs) n/a
7 ccsbBroadEn_02486 pDONR223 100% 78.3% 93% None (many diffs) n/a
8 ccsbBroad304_02486 pLX_304 0% 78.3% 93% V5 (many diffs) n/a
9 TRCN0000478841 CCCGTTTTCCTTAGTTCTTGTTCT pLX_317 78% 78.3% 93% V5 (many diffs) n/a
Download CSV